Busch Lab

ZMP

zufsp

Ensembl ID:
ENSDARG00000059983
ZFIN ID:
ZDB-GENE-070209-211
Description:
zinc finger with UFM1-specific peptidase domain-like [Source:RefSeq peptide;Acc:NP_001076474]
Human Orthologue:
ZUFSP
Human Description:
zinc finger with UFM1-specific peptidase domain [Source:HGNC Symbol;Acc:21224]
Mouse Orthologue:
Zufsp
Mouse Description:
zinc finger with UFM1-specific peptidase domain Gene [Source:MGI Symbol;Acc:MGI:1919830]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39114 Nonsense Mutation detected in F1 DNA Not yet available
sa42765 Nonsense Mutation detected in F1 DNA Not yet available
sa22887 Missense, Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3979
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Essential Splice Site 254 608 5 12
ENSDART00000141577 None None 108 None 4
Genomic Location (Zv9):
Chromosome 16 (position 34502666)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32234166
GRCz11 16 32188196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAGAGCATGTTGAGCTGCATTTGGAATACAGCTCWGCAWCTGCTACAG[G/A]TATGTGCATCTGTAATGTCAGCTCCACTGTTCYCATGCAMGGTTMATTAA
Long Flanking Sequence:
AATAATTTTCTCTTTGTTAATTGCAGAAGGATGCTTCCCATGTCCAATGTGCAATTTGGTTTACAGTGACTGCTTTGCTCTTCAGGAGCATGTTGAGATTCATCTACAAGACCAAGATGCAGGTGAAGGTTAAATATATCATAACCACAATATAACAGCAACAAGCGTATTTGAGTTTATTTTAAAATCTTTTTATCATTAACTGTCAATATTTGATATCTGATGGTTTGTCAGGAACTGGGTCTGATGTTGAAACATTAACTAAAATATCTGCTGAAAGCAATGACAGAGCGGGTGAGTTAGCTGCGATTTTAGTTATTTTGGTAGTTCTGCTCATTTAAAAAGTGGATCGGCAGGCTACATCAACCCAAATGTACCACTGTGATCTTCAGGTGGGATGCGTTATGAGTGTCCGATGTGTTCCCTGAGGTGTTCCTGCAGCAGTTCACTGCAAGAGCATGTTGAGCTGCATTTGGAATACAGCTCTGCATCTGCTACAG[G/A]TATGTGCATCTGTAATGTCAGCTCCACTGTTCTCATGCAAGGTTCATTAAATTTCTGGATGATCATGGATTTTAAAAGGTCTATTCCAGACGGTCCATGCGCTGAGCGCAAAATGCAGGGCGCAAACGCTTTCAGGGCGTGTCAGAACGCATTTTTGCTAATTTACGGACGGGAAAATTCGCTTTGCGCCATGGCGCATGGGCTAAAAGGGTTGAGTTTATTTTCTTAATGAGTTATAGGTGTGTTTTGAGAATAAACAAATTAGAGTCTCATCTCCCATTCCCTTTAAGAGCCAGCTGCGTCACGCCAAGAGCACATTCGCTATTTACAGGACGCAAAGTAAGTCTAAGTGGAAAAAATGAGCATTTCACAAGCAAACAGTTAACAGTTGACAGTTTTTTAACAGAAAACTGTTAAACAGAGCATCTACTGCGTAAGAATGAGAGATAATGGATCTACTTTCACATTTGCTCTTGGATAGGGAAACCTTTACGCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39114
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Nonsense 317 608 7 12
ENSDART00000141577 None None 108 None 4
Genomic Location (Zv9):
Chromosome 16 (position 34505113)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32236613
GRCz11 16 32190643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGTGGCTATCGGAAGCAAATGGAGAGGAATCTGGACAGGGCTGTGTCT[C/T]GAGGTCAGATGCTTCCTGCAGATTTCCACAGGAAGAGAGCGGAGATGCTG
Long Flanking Sequence:
TTAAAGGTCATGGAAATTCAGCTTTTTGTCTTTATTTCTTTTAGTGACAGTCAGGGAATTTTGCATTTGGCTTAGAAATGAATCCTGCAGCTCACACAATGTTACAAAACAGTTACGATTTATCATAGACCATACCATACACCCCAACTTCTGCTTTCTGAAAGGATCTTGACTTAAAGGTTCATTTGTTTGGGTGTTTTAAGGTCATTCACCGGGGGAAGATCTGACTCTGGCCAGGAAGCTTCAGGAGGAAGAGGAGCAAAACTGGAGGGAGGTACAGACAAGGCGGGAAGCTGAAGACTTTAAGAAGCTCCAGGTAATCTACTGAAAACCTCACTGTCAGAATTTAAAAAAATGTTAAGAAGAATTTTTTTTTCATTCTTGCTGTTTAGACACTTATTTCTTTCTTCATTGTTTGATTTCTTCAGAAGCAGTTTGGGCTTGATAACAGTGGTGGCTATCGGAAGCAAATGGAGAGGAATCTGGACAGGGCTGTGTCT[C/T]GAGGTCAGATGCTTCCTGCAGATTTCCACAGGAAGAGAGCGGAGATGCTGGAGTCTTTGGCCTCAGGGGTGGATGATGGCAGAAGCAAAACTTCAGGTCTGATTCTGACTGTTATCATAGTGCCACACTAATACTCTCTACTTACTTGATTCTGCTGGAAGATTATTAGGATCAAATTCTATCTCTTTTCAAATTAAGTAGAGAGAAAATTGTCAAAACTTTGGAGTCTGTAAGATTTTTTTTGTTTGGGGTGGCACGGTGGGTCAATGGTTAGCACTGTGTAGAACAAATTATAATGTAGATTAAAGTGCTCTCATATCTATATTATAATTTGTTACAACTGTCACCTCACATGGTTGCTGGTTCGAGTCCCAGCTAGGCCAGTTGGCATTTCTGTGTGAAGTTTGTATGTTCTCTGCGTGTTGGCATAGGTATCCTCTGGGTGCTTATTTTACCGTCAAGTTTCTGACGGTAAAATAAGTTCTTTTTAAATTTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42765
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Nonsense 336 608 7 12
ENSDART00000141577 None None 108 None 4
Genomic Location (Zv9):
Chromosome 16 (position 34505171)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32236671
GRCz11 16 32190701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGCTTCCTGCAGATTTCCACAGGAAGAGAGCGGAGATGCTGGAGTCTT[T/A]GGCCTCAGGGGTGGATGATGGCAGAAGCAAAACTTCAGGTCTGATTCTGA
Long Flanking Sequence:
TTTTGCATTTGGCTTAGAAATGAATCCTGCAGCTCACACAATGTTACAAAACAGTTACGATTTATCATAGACCATACCATACACCCCAACTTCTGCTTTCTGAAAGGATCTTGACTTAAAGGTTCATTTGTTTGGGTGTTTTAAGGTCATTCACCGGGGGAAGATCTGACTCTGGCCAGGAAGCTTCAGGAGGAAGAGGAGCAAAACTGGAGGGAGGTACAGACAAGGCGGGAAGCTGAAGACTTTAAGAAGCTCCAGGTAATCTACTGAAAACCTCACTGTCAGAATTTAAAAAAATGTTAAGAAGAATTTTTTTTTCATTCTTGCTGTTTAGACACTTATTTCTTTCTTCATTGTTTGATTTCTTCAGAAGCAGTTTGGGCTTGATAACAGTGGTGGCTATCGGAAGCAAATGGAGAGGAATCTGGACAGGGCTGTGTCTCGAGGTCAGATGCTTCCTGCAGATTTCCACAGGAAGAGAGCGGAGATGCTGGAGTCTT[T/A]GGCCTCAGGGGTGGATGATGGCAGAAGCAAAACTTCAGGTCTGATTCTGACTGTTATCATAGTGCCACACTAATACTCTCTACTTACTTGATTCTGCTGGAAGATTATTAGGATCAAATTCTATCTCTTTTCAAATTAAGTAGAGAGAAAATTGTCAAAACTTTGGAGTCTGTAAGATTTTTTTTGTTTGGGGTGGCACGGTGGGTCAATGGTTAGCACTGTGTAGAACAAATTATAATGTAGATTAAAGTGCTCTCATATCTATATTATAATTTGTTACAACTGTCACCTCACATGGTTGCTGGTTCGAGTCCCAGCTAGGCCAGTTGGCATTTCTGTGTGAAGTTTGTATGTTCTCTGCGTGTTGGCATAGGTATCCTCTGGGTGCTTATTTTACCGTCAAGTTTCTGACGGTAAAATAAGTTCTTTTTAAATTTCAAAAAAAAATTCTTTCCCTATTGAACACAATTTGTTTTATTTTAAGAAACATTTATGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22887
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Missense 534 608 11 12
ENSDART00000141577 Nonsense 108 108 3 4
Genomic Location (Zv9):
Chromosome 16 (position 34510171)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32241671
GRCz11 16 32195701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATCAGGCCACAGTCGTTCCATCATCGGAATGGAAGAGAAAGCGAATG[G/A]TAAACTATGCCTCCTCTTCTTCGATCCGGGGGTTACACCAGCAGAAATGA
Long Flanking Sequence:
AGACTTAAACACATCTGTGTAGCTGTGCCTTTACTTAACAAGCACTGCGCTTCGTCTGACAGCCACCATCATTTGTGTCTTTTTCTTTTTTCCCCAGTCCCCTTAAACCTGTTTCAACACATTTTAACCAGTTTTAATCATTTGTATTCTTTGTTTTTTATACTTGTTGTATTTTGTTTATGTTAACCACTTTAAATTGTGTATGAAATGTGCTACATGAATAATCTAGCCTTGCCTAAACTACACCACCTCCATCAAAAGCTATTGAGTTTACTGTCTCTAATAAACTCAAAGTAGCATAGACCAGTTTACCCCACACCATCAGACAGCAGAAGACACTTCATTGAATCCAGCCTGATGGTGTCTGTCAAAGCATTTTTTGGCAATTAAACAAGAATTTTAATGTGCTGTAATCTGAAGATTATGGAGGATTGATTGACATTTCTCTTTATGATCAGGCCACAGTCGTTCCATCATCGGAATGGAAGAGAAAGCGAATG[G/A]TAAACTATGCCTCCTCTTCTTCGATCCGGGGGTTACACCAGCAGAAATGAAGAAAGTGTTGTCTCAGGATACAGTAACGTCCATGGTACAACGTATGCGCAAATATACCAGTGGCCTAAAACACAAACAGTATCAAGTGGTCATTGTGGAAGGGGTGCTAACAGCTGAGGAGAAACAGGTAATGCAGACAAACAGCACAGCTTTGGGATCTCATTACTGTGCATGCTTTTTTAGGAAACATGACTGCTGAACCATACTGTTGTTTATATATTTTAATAATGTATGCCCCTTTAATGCTTAATTTGGATTTGAGGTCTTTTGTAATAGGTTTACATGGTTAAATTGGCACATTTCTGAGCTATTGATTGGATAATTACTTGGACCAGAAAAAGATACAATATGCTTTCCAATTTATTTAACACAGGGGTGTCAAACTCAAATCCTGGAGGGCTGCAGCCCTGCAGAGTTTAGTTCCAGCCCTGCTTCAACACACCTGTAGG
Associated Phenotype:
Not determined