Busch Lab

ZMP

herc4

Ensembl ID:
ENSDARG00000059936
Human Orthologue:
HERC4
Human Description:
hect domain and RLD 4 [Source:HGNC Symbol;Acc:24521]
Mouse Orthologue:
Herc4
Mouse Description:
hect domain and RLD 4 Gene [Source:MGI Symbol;Acc:MGI:1914595]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35603 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12438 Nonsense Available for shipment Available now
sa35602 Nonsense Mutation detected in F1 DNA Not yet available
sa17790 Essential Splice Site Available for shipment Available now
sa24948 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Essential Splice Site 129 1053 2 23
Genomic Location (Zv9):
Chromosome 13 (position 51408532)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50119629
GRCz11 13 50432872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGACAGCTCGGACTTTCCATTGTAGAAGACTGTCTGCGTGTGCCCAGG[T/C]AAAGATCAAATCAAGCATAAAATAAACAAAAATTAATAGATGAAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Nonsense 163 1053 4 23
Genomic Location (Zv9):
Chromosome 13 (position 51408080)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50119177
GRCz11 13 50432420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTATCTGAAATGATGTATTCCTCCAGGAGGCGAGMTATTCTCCTGGGGC[C/T]AGAATAAGTATGGTCAGCTGGGTCTGGGGCAGCAGGGAGCCTGTGTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Nonsense 182 1053 4 23
Genomic Location (Zv9):
Chromosome 13 (position 51408023)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50119120
GRCz11 13 50432363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATGGTCAGCTGGGTCTGGGGCAGCAGGGAGCCTGTGTCTGCTCTCCA[C/T]AGGTCATCCAGTCTCTGCAGGGCATCCCGTTCGGGCAGATTTCCGCCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17790
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Essential Splice Site 605 1053 14 23
Genomic Location (Zv9):
Chromosome 13 (position 51381877)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50092974
GRCz11 13 50406217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATAATTCTGCAGTGATCATTTTCTGATATCGTCTTTATAATCCMGTTGC[A/T]GGWCAATGAGCGTGCCGGACAGATCAWCCAGWATGATAAATTCTWCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24948
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Nonsense 639 1053 14 23
Genomic Location (Zv9):
Chromosome 13 (position 51381773)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50092870
GRCz11 13 50406113
KASP Assay ID:
554-7323.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTAGACGAGCTGATCGACATCAGGAATGATTATGCGACCTGGTTTCAG[C/T]AGCAGATGTTCTCTGTGGTTGGTTTATGATCATAACAAACACCCACACCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7738
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083883 Essential Splice Site 985 1053 22 23
Genomic Location (Zv9):
Chromosome 13 (position 51365528)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50076625
GRCz11 13 50389868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGAGGTTTTTCACGAGCTGCCTTTGGAGAAGAAGAAACAGTTCCTGTG[T/C]AAGTCAATCCTTTTGGAGTTTAGATTACTGAATACTCCTCGTTGGCYCCA
Associated Phenotype:
Not determined