Busch Lab

ZMP

frmd3

Ensembl ID:
ENSDARG00000059885
ZFIN ID:
ZDB-GENE-070523-1
Description:
Novel protein similar to H.sapiens FRMD3, FERM domain containing 3 (FRMD3) [Source:UniProtKB/TrEMBL;
Human Orthologue:
FRMD3
Human Description:
FERM domain containing 3 [Source:HGNC Symbol;Acc:24125]
Mouse Orthologue:
Frmd3
Mouse Description:
FERM domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2442466]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10479 Nonsense Available for shipment Available now
sa34496 Nonsense Mutation detected in F1 DNA Not yet available
sa27276 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760 Nonsense 112 603 5 14
ENSDART00000139494 None None 117 None 2
ENSDART00000142115 Nonsense 112 380 5 13
Genomic Location (Zv9):
Chromosome 8 (position 51927106)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49677493
GRCz11 8 49666262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTAAWGTCTGCTCTCTCTCTAATTTTCTCTCTATTTTCTCTTTCAGGTA[T/G]CTTCTGTATCTCCAGTTGAAGAGAGACGTGTATCAMGGCAGGCTGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34496
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760 Nonsense 128 603 5 14
ENSDART00000139494 None None 117 None 2
ENSDART00000142115 Nonsense 128 380 5 13
Genomic Location (Zv9):
Chromosome 8 (position 51927059)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49677446
GRCz11 8 49666215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATCTTCTGTATCTCCAGTTGAAGAGAGACGTGTATCACGGCAGGCTGT[T/A]GTGTCCATTCGCTGATGCTGCATATCTCGGAGCCTGCATCGTCCAGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27276
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083760 None None 603 None 14
ENSDART00000139494 Essential Splice Site None 117 1 2
ENSDART00000142115 None None 380 None 13
Genomic Location (Zv9):
Chromosome 8 (position 51883792)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49634179
GRCz11 8 49622948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCATCTTTCAGGGAATGAATAGGGATGGGAATGAAACCAGAAGGACAG[G/A]TTTGCTCTCCTACATGGGTTATTCATTCACATCTTCTTCTCTTTTTTTTC
Associated Phenotype:
Not determined