Busch Lab

ZMP

rptor

Ensembl ID:
ENSDARG00000059879
Human Orthologue:
RPTOR
Human Description:
regulatory associated protein of MTOR, complex 1 [Source:HGNC Symbol;Acc:30287]
Mouse Orthologue:
Rptor
Mouse Description:
regulatory associated protein of MTOR, complex 1 Gene [Source:MGI Symbol;Acc:MGI:1921620]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa33837 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11537 Nonsense Available for shipment Available now
sa18578 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26717
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Nonsense 152 1363 4 35
Genomic Location (Zv9):
Chromosome 6 (position 17467158)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17639653
GRCz11 6 17939619
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTACTTCACTACGCAGAAATGCCAAGGAGGAACGTGTTCTCTTTCACTA[T/G]AATGGTCATGGGGTGCCTCGACCTACTGTTAATGGAGAGATCTGGGTTTT
Long Flanking Sequence:
TCCACACTGCATCATTCTCTCTTTCTCACCTAGACTGGCAGATATAATAAATAGATTTCCATTGCTCTAAGTTTAAAGGCTTGTTGTAAAGCACAAACTTTATATTGAAATACTCTATGTTTTGAAATGTTGTACATTATCAGCCTCATTCTCTTGGCTGTGTCTTTTAACCTTGTCTATTATCATTTCAAAAAGGGCATGTGGTGATATAATTTGATTTTCAGTGACTGACATGTGTTCTATTGCAGACAATATTTACTATAATGTGCAATTAAGTTGTTGTTTAAACAAGTCATTATGATAAATGAGTTTTTTGATGTTTAGTTTAGTGCAGACCCATTATAAATTATTAATGCTTTTTATGTTTTTCATTGAAATATAATATTTTCTTTCCTACAGGCCCGGTATAAGCAGAGTTTGGACCCTACAGTTGATGAAGTAAAGAAGTTGTGTACTTCACTACGCAGAAATGCCAAGGAGGAACGTGTTCTCTTTCACTA[T/G]AATGGTCATGGGGTGCCTCGACCTACTGTTAATGGAGAGATCTGGGTTTTCAACAAGGTAAGACAAATAGATAGAGCCCTGCAAGCATTTTTGTGTTTAAAAAAAAGTGTTAATACATTTCTAATAGACAGCTTTGCAAAAACAAGGCAAATTTAGGGCTGCCAGTGAAAATGCAATAGATGTCTAAAATGTCAAAAAGCGACCAGTCATAAAATAGGCAGTTATGGAAGGATATTACAGACAATTTTCAGATGCATTTGCAAATTGGATTTTCAATTGTATTCACAATATGGGATAACAATATGGGAACATAAGTTGTGACAATCCAAATGCAACTGCAAATCCCACATTAGCAAACTCTTCATGACTGCCACATTTTAAATGAAAAAGCAAAGTCCATTTGCAAATGCATTGCTCATATCTTACGAGCTATAAGCCTGACAAAGCAATATTATATCTAAATAGCTTATATATCTTGTTATTCTTCTTAATAATATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33837
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Essential Splice Site 299 1363 8 35
Genomic Location (Zv9):
Chromosome 6 (position 17495532)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17611279
GRCz11 6 17911245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATGCTTATTCTTTACTTATTTTTCATGTGTTTCTGAACTTTTCTCA[G/A]GATACCAGGAAGGCTGAATGACAGGAGGACACCTTTAGGAGAGCTGAACT
Long Flanking Sequence:
AGTGAAGCCCCCAGAACGGTTTGATCTATCATTTTGCTATTCCACTTCAGTTGCTTCACTTCTAAATTGACTTTACTTTATTATCCACACTGTGTTAAATTGTTTCTGGCTTCACAATACATTACCACGTACAAATACACAACAGATACATCATAACTCATGTCAACTGTACTGTAGGGATCTATAGAAAAAAAGCAGTTCCAAATGTAGTTCTTACAATAAATGTTGAAGTATTGCAAATTCAGTTTGGTGGTGTCAATTATATATCTCAGCTCAGTTTGGTAACTTAATACAAATGTCTAGTGGCATTCTTTAGCTTAAATGGAGTTTTGTTTTTGTTTAGTTCAATAAAAAGTATGACATTTTGTATCTCAATATCTTTTTATTTATTGAGCATTTATGTTTTTTTTTATTATATATTTTTTATACAATGTTAGCCCTACTCATCTATTTAATGCTTATTCTTTACTTATTTTTCATGTGTTTCTGAACTTTTCTCA[G/A]GATACCAGGAAGGCTGAATGACAGGAGGACACCTTTAGGAGAGCTGAACTGGATTTTCACAGCTATCACTGACACAATTGCATGGAATGTCCTACCGAGAGGTTTGTTCAGATTAACACAAATGCCTATAGTACCCTTTTAATAAATTTATGTAAAGTGTTTTAATATAATTTTATCAAAATGACAGACTGCTGAGTTTTTCTACCTTCAATGACCATAACGTCCATAATTTTAAACTCTTCTTTATTCCTGAGGAGAAACCTGCTGTGATTGTTTGAGTACATTCTTACCTCTTTAATTATTGTGTATAAGAGAAATGCAAGTCTGCGTTATGCCCATTTCTAGGGTTTATATGCTGTGCACACATATCATTATCATAGGATTCCATTAAATGTGAGTATTACTGGTCCCACTTTATATTAAGTGGCCTTAACTAATATGTACTTAACCAGGAATTAATAGTTTGTTAAAATGTACTTATTGTGTAAAAACATGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11537
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Nonsense 443 1363 12 35
Genomic Location (Zv9):
Chromosome 6 (position 17563454)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17543357
GRCz11 6 17843323
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGAACATTATGCTAATGTTTTTCCATATRTTTTCTCTCAGGTCCTTT[T/G]AAGTCAGGTACACAGGCTGAGGGCGCTGGATTTGCTTGGACGATTTTTGG
Long Flanking Sequence:
GTACTTGTACATGTGTAATGACAATAAAGTTGAATCTAATCTAATCTAATCTAATCTAATCTAATCTAATAGTTTGATCGCAGTGTTTACTACAATAATGTCACTAATATATGCATACTCTATGTCCTAATTCCATTTCTGTTTAGTTCAGTTATGACTAGGTGGATTAAGGTAATCAAAACTCGCTGTTTTGAGCTTATGTAGGCCTACAGTTTAAAATTCTTGTTTAACTGAATATACAGTTAGTAAATACAAGTACATCTTATTGAACATAATTTATTTTCATCACCAATTATCATAGTAGAACAGTTTCTCAAGCCGTTTGTCATGCATTTTGGAAACAGTCTAATGTGCCACCTGGGTTGAGAAACCCGCCAAACTCGGTCAACTTTGTACTTGTGTACTAGCACATATATTCTTAATGCCTTCGTCAGACATCAATATACCCCTCACTGAACATTATGCTAATGTTTTTCCATATATTTTCTCTCAGGTCCTTT[T/G]AAGTCAGGTACACAGGCTGAGGGCGCTGGATTTGCTTGGACGATTTTTGGACCTGGGTCCTTGGGCTGTCAGTTTGGTGAGACATCATACAGCACACTTTTAACAGATATTTTTGACTGACTTTTACAGTAAAGCTTGTAACACAAACCATGGCTTAACATTACTTTAGGTAATACGCACTGTATGTAAGTTGGTTTATATACATAAATGTTAATAAGACGAGATCTGTGAAAGAAAAAATATCTAATTAAATCAAGAACATACAATTTTTGAAGAAAATGTTTGGCTGCCTTGTATAATTGTTATGCTATTATTGTTGTTTCTGTCACTTTTTTATGCTGTTGTTTTTTTTTATGCAGGCTCTTTCAGTAGGAATTTTTCCATATGTGCTAAAACTGTTGCAGAGTTCAGCGAGAGAGCTGAGGCCTCTTTTGGTCTTCATCTGGGCAAAGATCCTGGCTGTAGATAGTGTATGTATCTTAAATTGATTGCATTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18578
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Essential Splice Site 802 1363 20 35
Genomic Location (Zv9):
Chromosome 6 (position 17589762)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17517049
GRCz11 6 17817015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGACAAGATGAGAAGAGTCAGCTCAKACTCATCCTTAAATTCTCTCATTG[G/A]TAAGATTWCCTTTTTCAGCAGCAGACAAGACCGTTATTGGTTGTTACAAC
Long Flanking Sequence:
TTTCAACAATTTTCAATTATTAATCTTTAACAGATTAATATACACTATCTGCTGTTGTGAATGAAAAATAACAAATGAAGAAGAGAAAATAGCTTACTGCTCTTGACTAGATAATGTGTAGCTTTAATAATAAGAAGAAAAAGAAGAATTTAGTATTGCAATCTTTATTTGCAGTAATTAATAACAATAATTTAGCATTGAAATCGTTATTGAAAGTTTTATTATAAACAATGTGTTTGGAATTATATTGATATTGTAAAGTAAAATTACAGATACTATAATTTTGGTAATTTCGCCCATCCTCTCTGTTCCCAGCATTGGTCATTTTTGAATGTGTGTTTTAGGTGGTCCGGCAGCATTTTCTCCAGGGAACCTGAGTACCAGTAGCAGTGCCAGCAGCACTCTGGGCAGTCCTGATAATGATGAATACCTTCTCTCCTTTGAAACCATCGACAAGATGAGAAGAGTCAGCTCATACTCATCCTTAAATTCTCTCATTG[G/A]TAAGATTTCCTTTTTCAGCAGCAGACAAGACCGTTATTGGTTGTTACAACTGTTTGAAATAAAAAAAAATGCAGCTGACAACAGATAAAACATTGAAGAGAGCGTTCAATAGTTTGGCCAACCTTTTATACAGGCAAAAATTAATAAAAAATAGAATAAACTGGAGTGTTGATTGTGCCTCTACTGACACTGAATCAGTTTATAACTAATCATGACAATGTTTCTTATTACTTACATTGTGTAATTGTAATATCATAATCAAATAGGTATCTGAGCAAATTTTAAGACCAATCTGTTTGTCTGTAAGAAAAGCTTGTTTAGTAGCCAATATGAAACAAATCCTTTTTATAACACTCATAATAACCATTGTGTTGTGATGAAGAGTCAGATAAGTGTAGATCCTTTTGCAGCTTTTTATCAAAATCCAGATTAGTAGCAACAATACTCAGCATAAGAAGTCACAATGGCCAATCCAATAGACAAGCAAGTGTCTGGCAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3575
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083756 Nonsense 1135 1363 28 35
Genomic Location (Zv9):
Chromosome 6 (position 17629298)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17477513
GRCz11 6 17777479
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGATGGTCACAGCATGGCAAGGCYTGTCTGACATGCTGCCCACCACA[C/T]GAGGTTTGCTTTTTTATTTTATTATTTTTTTCTTTRTTTGTTTTTGTAGA
Long Flanking Sequence:
CAAAATAGCAAAAGTGGATTCGGACAAGACCTTAATACTTTTGCGCTTTGCACCTAGATTGTTAAAATAGAGCTCAATGTGTTCTTGTGTTCAATGAGATGCGTCATTGTGTGTATTTTGCAACATGTTATAATGTAGATTTATATAGGTAGGAATTGTCAACTGCATTAAAACTGTGTGTATTTGGAACAGTTTTTGGGACTGGGAAAAAGGAGAGAGGTTGGATTATTTTTATAATGGCAACCCACGGTACACGCGCATCACAGCCATGGAGTACCTTAATGGGCATGACTGCTCTCTTCTCCTCACTGCCACAGGTTAGTTCAGCTGCCAGCCATGTTGACACAAACATTTATTGCTTCCCATCCTATGGTGATTTGTATCATGCAACAATTTTTGCAGATGATGGAGCATTGCGAATTTGGAAGAACTTTGCTGACCAGAGAAATCCAGAGATGGTCACAGCATGGCAAGGCTTGTCTGACATGCTGCCCACCACA[C/T]GAGGTTTGCTTTTTTATTTTATTATTTTTTTCTTTATTTGTTTTTGTAGAAATTTATTTGTAGTTTTTTTAGTACCTCTTAAAATTGTTTTATATAATTTGTTTATTATTATTATTATTGTTATTATTTAATATCCTATTTTGTTTATTTCACAGTTGTTTGTGCTGGACAATATTGTATAGGTGTAGCTATTGTCCTAACCTTATGTAAAGCTCCCACTACAGGATTTTTTATTTATTTTTTAAACCAATTATGATCATGTCTGGTTCCAGTGTGCACATAAGAAAAATGTTCTCAAAATGTATTCTCTCAGTTCGCAAACATGCTCACAGTGTAAAAAAATCAAACCATGTGGTGCATCATTCACAACAGGATTATTGTAGCAAAGGGAGCACCTCACACAATCTAATGATGAAGCTGAATACCTACTGTGTGTAAACAAAATGTATAATGTAATACAACTTTCTTTATAAATACTTGTTATTTGTAGGTAGCTAGCA
Associated Phenotype:
Not determined