Busch Lab

ZMP

si:dkey-158a20.4

Ensembl ID:
ENSDARG00000059866
ZFIN ID:
ZDB-GENE-100921-39
Description:
hypothetical protein LOC100126813 [Source:RefSeq peptide;Acc:NP_001104563]
Human Orthologue:
C19orf29
Human Description:
chromosome 19 open reading frame 29 [Source:HGNC Symbol;Acc:29938]
Mouse Orthologues:
2510012J08Rik, Gm10654
Mouse Descriptions:
RIKEN cDNA 2510012J08 gene Gene [Source:MGI Symbol;Acc:MGI:1917562]
predicted gene 10654 Gene [Source:MGI Symbol;Acc:MGI:3643366]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33034 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33034
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083710 Nonsense 351 835 4 10
ENSDART00000147421 None None 188 None 6
Genomic Location (Zv9):
Chromosome 2 (position 50187940)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49883472
GRCz11 2 49617702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAGCATTTCAAAACATGGGCGGAGCAAGAGGACAACTTTCATCTGCAT[C/T]AGGCCAAACTCAGGTCACTCCCTTTACATTATAGAGAGGAAAAAGGGCTA
Associated Phenotype:
Not determined