Busch Lab

ZMP

si:ch211-196f15.1

Ensembl ID:
ENSDARG00000059858
ZFIN ID:
ZDB-GENE-060526-71
Description:
Novel protein similar to vertebrate pregnancy-associated plasma protein A, pappalysin 1 (PAPPA) [Sou
Human Orthologue:
PAPPA
Human Description:
pregnancy-associated plasma protein A, pappalysin 1 [Source:HGNC Symbol;Acc:8602]
Mouse Orthologue:
Pappa
Mouse Description:
pregnancy-associated plasma protein A Gene [Source:MGI Symbol;Acc:MGI:97479]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa44625 Nonsense Mutation detected in F1 DNA Not yet available
sa20570 Essential Splice Site Available for shipment Available now
sa20569 Nonsense Available for shipment Available now
sa12988 Nonsense Available for shipment Available now
sa13003 Nonsense Available for shipment Available now
sa33750 Nonsense Available for shipment Available now
sa9050 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25317 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 29 1624 1 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 29 1606 1 22
Genomic Location (Zv9):
Chromosome 5 (position 67371973)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63422580
GRCz11 5 64103779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTTTGCTTTTTCTCGTGTGCTTGGGATCAGAGTGTGGGACTCCACGG[C/T]GAATTGTAAGGTCTAAAAGAGACTTGGTACGCATCAGGGAAGCCAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20570
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Essential Splice Site 127 1624 1 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 None None 1606 None 22
Genomic Location (Zv9):
Chromosome 5 (position 67371675)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63422282
GRCz11 5 64103481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTGGATAAAACCCGAGGGTGGGCAACGCTCTCCAGCTGTTATCGGAG[G/A]TTTGGTTTGCTTAATTATGACTTGCATTATTATGTTCACCGCAGAAATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8212
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 333 1624 2 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 323 1606 2 22
Genomic Location (Zv9):
Chromosome 5 (position 67356621)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63407228
GRCz11 5 64088427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGCTTGCGGACAGACTGTGTGTGACAATGTGGAGGTGATTACAAACTA[C/A]TACCAGCTCTGGAGCTTCCGCAAACCTAAAACGGWGCGMTATCGAGTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3517
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Essential Splice Site 485 1624 2 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Essential Splice Site 475 1606 2 22
Genomic Location (Zv9):
Chromosome 5 (position 67356164)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63406771
GRCz11 5 64087970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCACCGATGTCACCAAGACCTGCTTTAATCCAGCGTCACCCCTCAGG[T/C]AATTCTTAAAACTTATTCATACACATAATTTCACATGCTTATTAATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20569
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 831 1624 7 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 821 1606 7 22
Genomic Location (Zv9):
Chromosome 5 (position 67308631)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63359238
GRCz11 5 64040437
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTAACAACGTCTCGCTGGGCCCTCAGTACGTGTTCTGTGACACGCTGT[T/A]AACGCTGAAGCTGGATGTGAAAGAGGAGGTGTACGGCGTGCAGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12988
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
Genomic Location (Zv9):
Chromosome 5 (position 67284523)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63335130
GRCz11 5 64016329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCATGTAACTCTTTTAATGACTTGTTGAAATGTGCATTGCTTTCAGAYA[T/A]CTTGGAGAGGAATGTGAKGACATGAACTTTGCTAATGGAGATGGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13003
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
ENSDART00000083684 Nonsense 948 1624 9 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 938 1606 9 22
Genomic Location (Zv9):
Chromosome 5 (position 67284523)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63335130
GRCz11 5 64016329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCATGTAACTCTTTTAATGACTTGTTGAAATGTGCATTGCTTTCAGAYA[T/A]CTTGGAGAGGAATGTGAKGACATGAACTTTGCTAATGGAGATGGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33750
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 1030 1624 10 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 1020 1606 10 22
Genomic Location (Zv9):
Chromosome 5 (position 67273615)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63324222
GRCz11 5 64005421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCAGTGGGCCACAGCAGTGGAGGTGTCCAATGAGGAGGCCATTCACTG[T/A]CCAGCTGAAGTCGCTGCTGGATATCCTGCCGTCACAAAGGTAAGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9050
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Essential Splice Site 1043 1624 10 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Essential Splice Site 1033 1606 10 22
Genomic Location (Zv9):
Chromosome 5 (position 67273575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63324182
GRCz11 5 64005381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YCATTCACTGTCCAGCTGAAGTCGCTGCTGGATATCCTGCYGTCACAAAG[G/A]TAAGATCATGGCTTAAAGTTTTAAARTTCTTTCCTGTGAGGGTTGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25317
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083684 Nonsense 1319 1624 16 22
ENSDART00000133766 None None 200 None 5
ENSDART00000135014 Nonsense 1309 1606 16 22
Genomic Location (Zv9):
Chromosome 5 (position 67228620)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63279227
GRCz11 5 63960426
KASP Assay ID:
554-7539.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTATGTTTGTCCTTTTGTCTCCACAGGCAGTAATAACGTGCTGACGTG[T/A]ATGGAGGATGGCATGTGGTCCTTCCCCGAGGCTCTGTGTGAGCTGCGCTG
Associated Phenotype:
Not determined