Busch Lab

ZMP

si:dkey-65b12.4

Ensembl ID:
ENSDARG00000059855
ZFIN ID:
ZDB-GENE-060526-328
Description:
Novel protein similar to human WD repeat domain 66 (WDR66) [Source:UniProtKB/TrEMBL;Acc:A3QK38]
Human Orthologue:
WDR66
Human Description:
WD repeat domain 66 [Source:HGNC Symbol;Acc:28506]
Mouse Orthologue:
Wdr66
Mouse Description:
WD repeat domain 66 Gene [Source:MGI Symbol;Acc:MGI:1918495]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11751 Essential Splice Site Available for shipment Available now
sa20505 Essential Splice Site Available for shipment Available now
sa12207 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11751
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665 Essential Splice Site 92 906 2 20
ENSDART00000147299 Essential Splice Site 160 906 3 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43394499)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41175764
GRCz11 5 41775917
KASP Assay ID:
2259-6335.1 (used for ordering genotyping assays)
KASP Sequence:
GCGGACATGGGTCAAGAGAGTCTTGWTATCATATGGGATGCTTATACAGG[G/T]TAAATCTGACCCTTTATTCTATTCCTATTGCTTTTGTAAATCCSCCCTTA
Long Flanking Sequence:
GGTCAAAAATCAATGTAAGTAAATAAAAAAAAATGTAGTTCCAAAAAAAAAAATAGTTCCAATGGCTGAACCCGCACTTATATAGTCAATACTCTAGTTTCTTTTTTCGACCTGTATCTAAAACTTAGTCCATCACACTTCCAGGTCCTTGAATGGGCTTATGGCATCAACTCAACCCTACCTGTTTTCAGCCTGCAGGATGAGGACAGGCTTGTCATCATCTATGCTTGTGCTCATGTTGCTGTCATTTATGATCACACTTCTAAATCACAGTACCTGTTACAAGTAAGAGACTTGTATTGTTTCAAACTTAAATGACTTACAAAATTAAATGTAAAGCCTAAAATGGTATTGTAAACATGCTGATTTTGTGCTGCTTGGTGTCTGCAGGGCCACTGCAGTCCAATCACCTGTCTGTGTACAAGTGAAGACAGACGTTGGATTGTTACTGCGGACATGGGTCAAGAGAGTCTTGTTATCATATGGGATGCTTATACAGG[G/T]TAAATCTGACCCTTTATTCTATTCCTATTGCTTTTGTAAATCCGCCCTTACAACTGACTTTAAAGACTTGATTATCATGCTTATGCATTGGGCAAAACAGATCTTTTTCACATTTAAGTGAAATGGATTTATCAAAAAAAAAAAAAAGAAGAAGAAGTACTGAACTTTTCGGTTGTTGTTTGGAAGAAAGCCAGTCAACTTTATATGTGCTTGTTGTAAACTTAGAGAAATGGGTAGAGTTTAGGCAGACTAAATGAATCGAAATGTCAGAAATAGCATATATACATAGATGAACTGTTCACAGTAAGTTACATTTACCAGCATTTGATACATTGGTTCACCTGTTCATTAACATAATTAATGAATTAGCCAGCCACATGGACATGTTACACATGACTTAAGTGAATTTGAAAGTGGCCTGGATGTTGGTACTAGATGGACAGGCCAAAGTATTTCAGAAAGTGCTGGTATCTACAGGGGTTTGCACACACAACCTAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8200
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665 Essential Splice Site 198 906 6 20
ENSDART00000147299 Essential Splice Site 264 906 7 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43397097)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41178362
GRCz11 5 41778515
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAGGAAAGGGGACATCTGGAATACTCAGCACCTGAAATTACTGATAAG[G/A]TTGGCAGAAGAATCTTTTTTCAGGATTAACTTTTTGTGTTGCTGCAATGA
Long Flanking Sequence:
ATAAATGAAGAACTAAAGGGCTTGGAATTATGAGGATGAGTAATTAATAACATAATATATTTTTTAATCACATTAAAGATATATAGTCACAGATTAATATAACTAGCAACAAATAAACTTTTTTTCTATGTCAGCGAGTGTGTATTAGGAACTGGACGGATGAAAGCGAAGAGCCAGCATGTCAAGTTGACCTCAGCCCAAAATATGGTTGCCAGGTATGCTGTAAAAGTATGAACACTAGTTATCAATCAACATTTGATGTATCCATCATCAAATAAACTCTCAATGTTTTCCCAGAAACAAATACTTTTCAATCCCTCTGACAGCACACAGCTGGTCAGCAACAGCAGCTCTCAGGTTCTCTTCTACAACTGGGTATGGATTATTTATCTGTTTGTCTTACTGATTTACAGTTGTAGTTGTATTTGCTTATAGCAAGGAATTCTGTTGCTCAGGAAAGGGGACATCTGGAATACTCAGCACCTGAAATTACTGATAAG[G/A]TTGGCAGAAGAATCTTTTTTCAGGATTAACTTTTTGTGTTGCTGCAATGAATGAGAGTATTCTGCTCTGCTTTTGGCATGACTTCTTGCAAATTTCTCTCCATCCAGACCTTTAATGCAGTGATAGGTTCCCTGAGCCAGTCCGTCTTCCACTACGATGGTGTGCAGGCTTTTACAGCCACCTCAGATGGGAATATAATTCTCTGGGACAAGCAAACGGAGTCTGTCTCTCGTCAGCCCATAGTGAGGAACGCCATAAAACTAGTTTCTATGCAGAAGGAAGCGATCACTGTTTTGACTCTGATTGACAGGTATATGTGACACATAGATACAGTATATAGTGTGTTGTGCATGAAGATGCATCAGATAAGTCCTAATAATCTAATTGTACAATTTTTGTACATTTGTCTTTTGTCAAGTTTTATAGTAACAGGTGATGTGAACGGACACATCAAATTCTACGATGGAAATCTCAAGCTTATCAACTTGTACAATGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20505
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665 Essential Splice Site 413 906 9 20
ENSDART00000147299 Essential Splice Site 479 906 10 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43398692)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41179957
GRCz11 5 41780110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTCCTGTCCCACAAACAGATCCAGTGCATTGCCTATGATCCACAAGG[T/G]GAACGTTTCATTGTTGTATTACCATATTTTACGGGTCATTTGTTTGCTGT
Long Flanking Sequence:
TTGTTAAGAAAGAAAAAATACATGGATTACTCTAAAAAACAGAAACAGTAAGAACTTATTTTGTGTTCTATAGAATAAAGTATACTAATTTGGAATGAGGGTGATAAAATAATTTCGTTTTAAAGTATTTCTCTTATGCATTTCCATCTTTTATGTCACCATTTTCATACTTTCTTCAGGCAGGGATATAGAGGCATCATTTTTCAACTCTACAGTGTAATAAACTCTTTCTCTCCTTCTATTTACAGAAATTTTGTCCTCTCTACAACTCATGCAACTGTAGTACATGTAAACACACAGACAAATGTTCCAAAGAGCCTTCTGCGGGAACATGCAGAACCTCTGGAAGCAGTTGCCTGCCATCCTAAACAACCATTGGTAGCTATGGGCAGCCACAGCGGCACCATTAAGGTATGGGATTATCAGCATAAAGAGGCCGTCTGCAGCAGAGTTTTCCTGTCCCACAAACAGATCCAGTGCATTGCCTATGATCCACAAGG[T/G]GAACGTTTCATTGTTGTATTACCATATTTTACGGGTCATTTGTTTGCTGTCAATTTACCCACCCTCAGCCCATCCAAGATGTAGTTGACTTTTTTTAATCAGTGCAACAATAAATTACACTTTTAGCTAAAACTGTTGGTGATTTATAACTTGCAAGTCCATTAACTTAAAAAAAAACATCAGCAGGCAAAATGAAATTATAGAGTTCTTATTAAATGAGATGATTGGTCTGTGTGAGTATTATGTGAAGGGATGCTGACAACAGAGGTGCGGATCCAAATCCAGGGTTTATTAGGAGAATGGTCAGGCAAGCAGCAGTCAACACAGAAACAAACAGACGTATATGGGCAATCCAGAGTCATGGTCAATACACAGGTGAATGGTCAGTAGAAGCAGTCAGCAGACAATGTAAACAAACAAACAAGGCGAGGTCAAAACACGGCAAATTAAGGCAAGAGAAATGCGCTGTAATGTTCACAGTAACAGATGAACAAGACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12207
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665 None None 906 None 20
ENSDART00000147299 Nonsense 903 906 18 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43405822)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41187087
GRCz11 5 41787240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGATGAACTGCTTGAGCTACTGCAGGCTAGAGGTAAGTTTTTTATTTTT[A/T]AAGATTGTAATTAACAGAGAAAGATTTTGGTTACTGCATTTAAGAGGCTG
Long Flanking Sequence:
TTAGGAGATGGAGGAATATTTTTACTACTTTCAGCTACTGGACCAAAACCTTGACTCTATGGAAACCCGGCTTGTGTCCACACGCATCCCTCTTGCTGATGTGCCCTTCTTAATGCGAGCCCTTGGCTTCTATCCCACAGAGCAAGAGGTACAAGCACTGTTGCAGTCACCAGTTGACTCTACAATACAGATCTGTCATCAACAGGTGGACTAGCACTCAATATTTTGTCAACCCACTTTTTGTTTTGTTGAAGCTGGAAGACATGCAAAATGAGGTGAAGTTCAGCCGCTATGCTGAAACCAGAAATTATGTGACAGACATCGATCTGGAGGAGTTCATTAGGCTGTATGTCAACCACAGACCTGCCTCTGGCATTTCCAGGCAGGAGCTGTACAATGCCTTCCAGGTGCTTGGAAAGCCAGACGAGGAGGGCAGGTATAATATTGACAGGGATGAACTGCTTGAGCTACTGCAGGCTAGAGGTAAGTTTTTTATTTTT[A/T]AAGATTGTAATTAACAGAGAAAGATTTTGGTTACTGCATTTAAGAGGCTGTGAATTTGGTTATAATATACACTTATATACACTACCTGACAAAAGTCTTGTCGTTGATCCCAGTTGTAAATGCAACAAATAATAACTTGAATTCTAGTTGATCATTTGGAAAAATTGTTTATTTTGGTAGTGGTAGATTTTTTTGTTGAATAATCTGTTGAACTGCATCCCAATCATCAAAATACAACAGAAGACGTATTGGAATGGTTTGGAATCATGGACCCAGAGTTCTAACAAATATCAGTCAAGTTTGGTGAAGGAAAAATTATGGTTTGGGATTACATTCAGTATGAGGGTGTAGGGTCCACCCAGTTGGTCCAATGACGGTATCCAATGGTGGATGAAGGTTCACTGCATGTTCGGTCTTTCCAGTGCACAATGTTGATTTATTTTAAACTTAACTCATATCTGACTCCAATTTTAGTATGAGGTGGTTTAGAATATTAATAT
Associated Phenotype:
Not determined