Busch Lab

ZMP

fam135a

Ensembl ID:
ENSDARG00000059843
ZFIN ID:
ZDB-GENE-080130-1
Description:
hypothetical protein LOC566435 [Source:RefSeq peptide;Acc:NP_001139066]
Human Orthologue:
FAM135A
Human Description:
family with sequence similarity 135, member A [Source:HGNC Symbol;Acc:21084]
Mouse Orthologue:
Fam135a
Mouse Description:
family with sequence similarity 135, member A Gene [Source:MGI Symbol;Acc:MGI:1915437]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa14063 Essential Splice Site Available for shipment Available now
sa11265 Essential Splice Site Available for shipment Available now
sa42274 Nonsense Mutation detected in F1 DNA Not yet available
sa16461 Essential Splice Site Available for shipment Available now
sa38968 Nonsense Mutation detected in F1 DNA Not yet available
sa42275 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14063
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 181 1338 5 20
ENSDART00000131434 Essential Splice Site 181 1338 7 22
ENSDART00000147971 None None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39762036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39076137
GRCz11 13 39202027
KASP Assay ID:
2260-6827.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCCACAATCCATGCTTCACTGGTGGCTCTGCATCAGCCTCTAATAAGG[T/G]CAGTGGTGCACTGAGAACTGGACCGACAGATTGTACTAGTCATTTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11265
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 181 1338 5 20
ENSDART00000131434 Essential Splice Site 181 1338 7 22
ENSDART00000147971 None None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39762036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39076137
GRCz11 13 39202027
KASP Assay ID:
2260-6827.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCCACAATCCATGCTTCACTGGTGGCTCTGCATCAGCCTCTAATAAGG[T/G]CAGTGGTGCACTGAGAACTGGACCGACAGATTGTACTAGTCATTTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42274
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Nonsense 285 1338 8 20
ENSDART00000131434 Nonsense 285 1338 10 22
ENSDART00000147971 None None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39768343)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39082444
GRCz11 13 39208334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTGCAATCCCACCACTAGCCAAGCCCAGCATGCAGGTCCTTTATGAA[C/T]GAGTTCTCAGAAGACCTTACCCTCCAGGCCAAAGGCACGTCTACATAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 301 1338 8 20
ENSDART00000131434 Essential Splice Site 301 1338 10 22
ENSDART00000147971 None None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39768393)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39082494
GRCz11 13 39208384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGTTCTCAGAAGACCTTACCCTCCAGGCCAAAGGCACGTCTAYATAGG[T/C]AYGTCCYTCCAAAACCGACCCTAAGCTCCACACGCCTCTTGCCTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38968
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Nonsense 315 1338 9 20
ENSDART00000131434 Nonsense 315 1338 11 22
ENSDART00000147971 Nonsense 29 160 2 5
Genomic Location (Zv9):
Chromosome 13 (position 39768817)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39082918
GRCz11 13 39208808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTAGAGGAACTTGATGTGGAGGTCCGACTTCATGAGCTTTGTGAA[C/T]AAGTCAAGGTATGGAATGAATTTAAGACTAAAGTTAGACCGTGCATTGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30545
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 446 1338 12 20
ENSDART00000131434 Essential Splice Site 446 1338 14 22
ENSDART00000147971 None 160 160 5 5
Genomic Location (Zv9):
Chromosome 13 (position 39774827)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39088928
GRCz11 13 39214818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCCTACCAATCATCTTTGAGGACAGATATTTGGAGTCTGTTACTGAAG[G/A]TATGTGCACTGGTGGTACTCCATTGATAATATATATTGATATAATTTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4525
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 1112 1338 15 20
ENSDART00000131434 Essential Splice Site 1112 1338 17 22
ENSDART00000147971 None None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39780937)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39095038
GRCz11 13 39220928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGTTGCCTGGAGCTAGGATAGATTTTCTGATGTCTGAGCGAAATCAGG[T/C]AAAGAGCAAAACAGTCCGATTAGATGGGCAGTTTATTGATTCAATAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42275
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083641 Essential Splice Site 1196 1338 17 20
ENSDART00000131434 Essential Splice Site 1196 1338 19 22
ENSDART00000147971 None None 160 None 5
Genomic Location (Zv9):
Chromosome 13 (position 39783915)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39098016
GRCz11 13 39223906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACCTCACCTCGGCACACTGTACAACAGCTCAGCACTCGTCAATACTGG[T/C]AACCCGCAGTAGTTTTCTGAAAACAACAGTTTATGAGCTGTTATGTGGTA
Associated Phenotype:
Not determined