Busch Lab

ZMP

crtac1

Ensembl ID:
ENSDARG00000059826
ZFIN ID:
ZDB-GENE-030131-9704
Description:
cartilage acidic protein 1 [Source:RefSeq peptide;Acc:NP_001073647]
Human Orthologue:
CRTAC1
Human Description:
cartilage acidic protein 1 [Source:HGNC Symbol;Acc:14882]
Mouse Orthologue:
Crtac1
Mouse Description:
cartilage acidic protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920082]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25687 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25687
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083586 Nonsense 262 546 6 14
ENSDART00000129710 Nonsense 262 546 6 14
ENSDART00000147212 None None 86 None 4

The following transcripts of ENSDARG00000059826 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 55482503)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54265442
GRCz11 1 54943093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCGACAATGAAAACGGGCCAAACTTTCTGTTCAAGAACAACGGAGAC[G/T]GAAGCTTCAGCGACGTGGCGTCAGCGGCAGGTGAGACGTCAGACATATTT
Associated Phenotype:
Not determined