Busch Lab

ZMP

LOC799274

Ensembl ID:
ENSDARG00000059818
Human Orthologue:
KIF5A
Human Description:
kinesin family member 5A [Source:HGNC Symbol;Acc:6323]
Mouse Orthologue:
Kif5a
Mouse Description:
kinesin family member 5A Gene [Source:MGI Symbol;Acc:MGI:109564]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17684 Nonsense Available for shipment Available now
sa7055 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9911 Nonsense Available for shipment Available now
sa16963 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17684
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Nonsense 222 992 8 26
Genomic Location (Zv9):
Chromosome 6 (position 58694413)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58797541
GRCz11 6 58791772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCACAGYATATTCCTGATCAACATTAAGCAGGAGCATGTGGAGACMRAG[C/T]AGAAACTCTGTGGAAAACTCTACCTGGTGGAWCTGGCCGGCAGCGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7055
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Essential Splice Site 238 992 8 26
Genomic Location (Zv9):
Chromosome 6 (position 58694361)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58797489
GRCz11 6 58791720
KASP Assay ID:
554-5378.1 (used for ordering genotyping assays)
KASP Sequence:
GAAACTCTGTGGAAAACTCTACCTGGTGGATCTGGCCGGCAGCGAGAAGG[T/G]CATTCAGTGTRTTTRTGTYTTCATCACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Nonsense 621 992 16 26
Genomic Location (Zv9):
Chromosome 6 (position 58683684)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58786812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTGGAGAGYCTACAGACCGACTGTCACCRAAAGATGGAGGAGACCGGC[A/T]GAGAACTGTYCTCCTGTCAGCTGCTYATYTCACAGGTMACACACACACAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16963
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090634 Essential Splice Site 632 992 16 26
Genomic Location (Zv9):
Chromosome 6 (position 58683647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58786775
KASP Assay ID:
2259-8293.1 (used for ordering genotyping assays)
KASP Sequence:
GGAGGAGACCGGCWGAGAACTGTYCTCCTGTCAGCTGCTYATYTCACAGG[T/C]MACACACACACASASACACACACASACACACACACAGACACACACACACA
Associated Phenotype:
Not determined