Busch Lab

ZMP

smpd5

Ensembl ID:
ENSDARG00000059811
ZFIN ID:
ZDB-GENE-061110-22
Description:
sphingomyelin phosphodiesterase 5 [Source:RefSeq peptide;Acc:NP_001071083]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22962 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22962
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083558 Nonsense 218 545 2 8
ENSDART00000124691 Nonsense 218 545 2 8
Genomic Location (Zv9):
Chromosome 16 (position 57060925)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53643490
GRCz11 16 53530317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCGATGCAATTGAAGTCAACGAAATAACTCCAAAACCCAATTGCAAC[C/T]AAAACTCCAACCACCAAAAGCATCCGCCACGATCTTTACGAACTCTTCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28760
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083558 Nonsense 388 545 4 8
ENSDART00000124691 Nonsense 388 545 4 8
Genomic Location (Zv9):
Chromosome 16 (position 57067880)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53650445
GRCz11 16 53537272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTCAACATGTTGAGCAAGTGGACGAGTGAATTTCAGACGCTGAAC[A/T]GACGAGATGATGAGCTGCCTTTATTTGATGTTCTCTGTGGAGACTTCAAC
Associated Phenotype:
Not determined