Busch Lab

ZMP

cask

Ensembl ID:
ENSDARG00000059809
ZFIN ID:
ZDB-GENE-020802-4
Description:
peripheral plasma membrane protein CASK [Source:RefSeq peptide;Acc:NP_694420]
Human Orthologue:
CASK
Human Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) [Source:HGNC Symbol;Acc:1497]
Mouse Orthologue:
Cask
Mouse Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa17097 Essential Splice Site Available for shipment Available now
sa34684 Essential Splice Site, Splice Site Available for shipment Available now
sa41463 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1081 Nonsense F2 line generated Not yet available
sa14058 Essential Splice Site Available for shipment Available now
sa11434 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17097
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 124 899 4 27
ENSDART00000100849 Essential Splice Site 130 907 5 26
ENSDART00000144150 Essential Splice Site 124 901 4 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34472585)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33628531
GRCz11 9 33439277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAG[G/A]WAAATTCAGYGATGTCTCACTGCTTCAGATTACCATGAATTTGACGAAAA
Long Flanking Sequence:
ATTTCCATCATAGTTTAATCAATAATTTGAGAAATATTTTGTACTGAATCACTTTTCTCCTATTCATTGTATTAGATCAATTTTATACACTTGAATATTAGATCACTTATAACAAGGAGACATAATAGTGCTGTGAAATGAAATCATAAGTACACTTCACAACTGATTATTCCAGCATTCATCTTTAATGATGATGATTTTCTGTCTTTCAGCATGGATGGAGCAGATCTCTGCTTTGAGATTGTGAAGAGAGCAGACGCTGGCTTTGTTTACAGTGAAGCGGTAGCCAGGTAAACACCTATAAAGCCATTCATCTGCTTTTTGTTTCTGTGCTCTACTTTGAGATGTACACCGAGACTGACTGATAAAAGTGAGTTCACCCAGAGAGAAAATTGTCATCATTTACCCTTCTCTCGATTTCCTTTAGTCACTACATGAGACAGATCCTAGAGGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAG[G/A]TAAATTCAGTGATGTCTCACTGCTTCAGATTACCATGAATTTGACGAAAACCCTTTTTAAAAAAACCCTTTTAGAAAACCCTTACCACTTCCTCTGTTTTAGTGAGAACTAGCAAATTACACATTACCATCATCACACTAAGAATAAACTGCTTCAAAAACAGCTGCTCTTTTCTCATAAGTAGCCTGCAGCCGCCAGTGTTTAGTGGTCAGTTGCTAAGTGATGAGCGCATAACCAGTTGATGTAATTTTAATCAAAGCTCCCACCAATAAACCACAATTAGGCCAGTTTCAGTGTGGATTGAGTCTGTATTTTGTGTGGCAGTTCAAATGGATTAGATCATAAACATTGGATTTGCTCTTCAGTGTTTGAACTTTCAGCAGTGAAATTTAAACCATGCTGAACTGAACTTCAACTCTGAAAACAGGACTGACAGTTTCAATTTACTTGAACTTCTATGTTAAACTGCTTTGACACATCTACATTGTACAAGTGCTATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2530
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 124 899 4 27
ENSDART00000100849 Essential Splice Site 130 907 5 26
ENSDART00000144150 Essential Splice Site 124 901 4 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34472584)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33628530
GRCz11 9 33439276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAGG[T/A]AAATTCAGTGATGTCTCACTGCTTCAGATTACCATGAATTTGACGAAAAC
Long Flanking Sequence:
TTTCCATCATAGTTTAATCAATAATTTGAGAAATATTTTGTACTGAATCACTTTTCTCCTATTCATTGTATTAGATCAATTTTATACACTTGAATATTAGATCACTTATAACAAGGAGACATAATAGTGCTGTGAAATGAAATCATAAGTACACTTCACAACTGATTATTCCAGCATTCATCTTTAATGATGATGATTTTCTGTCTTTCAGCATGGATGGAGCAGATCTCTGCTTTGAGATTGTGAAGAGAGCAGACGCTGGCTTTGTTTACAGTGAAGCGGTAGCCAGGTAAACACCTATAAAGCCATTCATCTGCTTTTTGTTTCTGTGCTCTACTTTGAGATGTACACCGAGACTGACTGATAAAAGTGAGTTCACCCAGAGAGAAAATTGTCATCATTTACCCTTCTCTCGATTTCCTTTAGTCACTACATGAGACAGATCCTAGAGGCGCTGCGGTATTGCCATGACAACAACATCATTCACCGGGATGTGAAGG[T/A]AAATTCAGTGATGTCTCACTGCTTCAGATTACCATGAATTTGACGAAAACCCTTTTTAAAAAAACCCTTTTAGAAAACCCTTACCACTTCCTCTGTTTTAGTGAGAACTAGCAAATTACACATTACCATCATCACACTAAGAATAAACTGCTTCAAAAACAGCTGCTCTTTTCTCATAAGTAGCCTGCAGCCGCCAGTGTTTAGTGGTCAGTTGCTAAGTGATGAGCGCATAACCAGTTGATGTAATTTTAATCAAAGCTCCCACCAATAAACCACAATTAGGCCAGTTTCAGTGTGGATTGAGTCTGTATTTTGTGTGGCAGTTCAAATGGATTAGATCATAAACATTGGATTTGCTCTTCAGTGTTTGAACTTTCAGCAGTGAAATTTAAACCATGCTGAACTGAACTTCAACTCTGAAAACAGGACTGACAGTTTCAATTTACTTGAACTTCTATGTTAAACTGCTTTGACACATCTACATTGTACAAGTGCTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34684
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 218 899 6 27
ENSDART00000100849 Splice Site None 907 None 26
ENSDART00000144150 Essential Splice Site 218 901 6 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34449771)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33605717
GRCz11 9 33416463
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAAAGAGCGCCTCTTCGAAGCAATCATTAAAGGAAAATACAAGGTAG[T/C]AGTTTAATAGCATAGTTTGGAGAGACGAAACAGACCTCTTAGGGCCTTTA
Long Flanking Sequence:
AAAATAACATCCTCTTTTTATTATCTTGGCTTGAAGAACTAAAACTCTTCCGAATGTAAAGTTTCGCTTGTAGCATGAATAGTAATCATGGTTTTAGTTCCCTATTGTTTCAAACAAATCCATCAACACCTTTAGGGCATAACACTTAGTAAAGTTTGTCTTAAATTTTGAAGCATTCAGACAGTGATTAACTGTATAACTCTGTCACTGTTGCTGTTTGTAACTGACTATGTGTGCTTGATTGTTCAAATATTGTATTAGTGACATCTCTTTTGTATGTGATTGGATAAATGCTTGCTTGTCTTGTGTGTTTTCCACAGGCAGAGTGGGCACACCACACTTCATGGCCCCTGAAGTGGTGAAAAGAGAACCTTATGGGAAACCTGTGGACGTTTGGGGCTGTGGAGTCATTCTCTTCATTCTGTTGAGTGGCTGCTTGCCCTTCTATGGCACCAAAGAGCGCCTCTTCGAAGCAATCATTAAAGGAAAATACAAGGTAG[T/C]AGTTTAATAGCATAGTTTGGAGAGACGAAACAGACCTCTTAGGGCCTTTAAAATGAAGTCAAGCAAGCAAACCGCAGTCATTTCATCAGCATATACTTTTTTAATAGCCTGGATCACGAGGTAAGATCTTAAACCATCATTTCCATTGGCTTAGTCCCCTATTTATTTGGGGTCGCCACAGCAGAATGAACCGCCAACTATTCCTGCATATATTTTACACATCGGATGCCCTTCCAGCTGCAACCCAGTACTGGGAAACACCTCACCTATACAATCTCGCATTTAAACATGCACTCATATATATGGCCAATTTATTTCAAATCTAATTCACCTATAGTGCATGTCTTTGGACTGTGGGGGAAACCAGAGCATGCGCGCGAACACAGAGAGAACATGCACACAGAAATGCCGATAGTTAACACATGAATTACTAACCAGAATACCATAAACCATAATCAGGAACCACTAACATCAGATTATATTTGGACACTGCATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41463
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 360 899 10 27
ENSDART00000100849 Essential Splice Site 366 907 11 26
ENSDART00000144150 Essential Splice Site 360 901 10 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34440159)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33596105
GRCz11 9 33406851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTCTACACAGCGTCTTCCAGGACCATCACCTTCACACATTGCTTGAT[G/A]TAAGCGACTTTATTTTACGAGTAAACACACTCACACATTAAACCTGTAAA
Long Flanking Sequence:
TAGTTATTTCCCCTGTAAAATTTAACACAGAATATAACCAGCAGCTATAGACTTTCATACATTTCCTCAGTGATATGATGCTGAAAATATAATATAAATGTGCATTTGTTCAAATTCAAGCACCATTCTATTTTTTTATGTGTGCACTTAAGAATGTGGCTGCATCCCATCTCCATTCATATCACAGTTCATCCCTGTATTGTTAAAATAACGCCTGTCGCTTGTTTTTATGCTGACCGCCCCGCAGGATTACTAGCGGCAGAAAGTAGGTGTCACTGCCTGTTCTCTCACAAAGTATAAGTGTATACTATTTTCAAATGAATGCTTTATTTTCTTGGTTTCTAAAGATCACTTTGGTTTGTGTGTGTTCTTGTAAAGGAGCTGTATCACAAGTGCTGGACAGTTTGGAGGAGATCCATGCGCTCACAGACTGCAGTGAGAAAGATCTAGACTTTCTACACAGCGTCTTCCAGGACCATCACCTTCACACATTGCTTGAT[G/A]TAAGCGACTTTATTTTACGAGTAAACACACTCACACATTAAACCTGTAAATTACAATTAGTTTAAATTACTAGATCATTTTTTTACTGGCATTCACACATTAGTACTAAAATACGTTGATAATTACTACTAAATGATTAAAGCTTCTCCATTTTTTTATTCAACCATAAGAAGCATTTAAATATAACATTTTGTTCAGTTTGCCAACATTTAATTGCGTTAAAGATAACATGATAATACAGAATATGTTTTTGTTCTAAAAACACAAGATGCTTAATAATAGCTATAGTACTGAAGTTACAGTCATCGGCCACTTTATTAGGTACACCTTACTAGTACCATGTTGGCCCGTCTTTTGCCTTCACAACTCCCTTACCGCCTGTGGCATTGATATGATGCTCAAGTGGTACTAATAAGCCCAAAGTGTGCCAAGAAAATATCCCCCACACCATTACACCACCACCACCAGCCTGAACCTTTGATACAAGGCTGGAGGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1081
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Nonsense 522 899 15 27
ENSDART00000100849 Nonsense 528 907 16 26
ENSDART00000144150 Nonsense 522 901 15 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34423321)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33579267
GRCz11 9 33390013
KASP Assay ID:
554-0983.1 (used for ordering genotyping assays)
KASP Sequence:
TACACATTGGAGAYGAGATCCGGGAGATCAACGGTATAAGTGTAGCAAAT[C/T]AAACAGTGGAGCAGCTTCAGAAAATGCTTGTGAGTARTAATATATTTAGA
Long Flanking Sequence:
TGATTCACAGACAAGGTACATGCACCAGATTGTTTTCCCTTAAATCCTGCTTGTGTTTAAAACGTATCCTCACATTGCTTCAGATTCACCTCCTCTGGGTTTCTCCTATATATCAATTTCTCTGTATGCACTTGATGAACTAATATGAATACGATGCCATCAGTTATTCCCCACAGCAGAACACATATTTCCACATGGCAGGGTTGAGAGTTTTATATTATCGGCCTATGATGGGCAGATTGCACATTCCCTTAGAACTTAACATCATCGTGATAATGGCCATAACCACATGCCACATACACACGCCACCATTATCTATTTGCAGCTTGCAAACCGAATAAGCTTATGTACTTGAAGATCTCAAACTGTGAAATTAGACTAGAATGAAATTTGATTTCCTGTTTTGAAATGTACTAATGCATGAAACCTCTCACCTCAAATTAGGAACTTTACACATTGGAGACGAGATCCGGGAGATCAACGGTATAAGTGTAGCAAAT[C/T]AAACAGTGGAGCAGCTTCAGAAAATGCTTGTGAGTAGTAATATATTTAGAATCTCTTCTCTTCTAATAGGGAATAGTTTATGCAACAATGTACATTTTGTCTTCAGTAGCTACATTTCCATCCATCTATTCTTATGTGCATTTTGGATATGCCCATTAAAAAACTGTTGATGGAAACCGTAAGATGCACATAAATTTTGAAAATGCGCTTAACTGAGCAGGATAAATTTTTTATTCGGTGAGAAAAGATGCGCATGAGCCTTGATCGAAACACCTTTACCGAAGAAATCCCTGTATGTACATAAAAAGTCATGTAATTTAGTTATAAGAGATCATATGATGATAAAAATTTGTGTGAATGGACAAACCAGCAGGCTAAGCACATTGTAAAACATCTGAAAGGTCATTCTAGAACACCTTAATCAATTGATTTATTAAATAAAGAAAAGATTCATGCAGCTTCTCCTACCTCAGCAAATAACTAATATTTGGCAGCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14058
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 555 899 None 27
ENSDART00000100849 Essential Splice Site 561 907 None 26
ENSDART00000144150 Essential Splice Site 555 901 None 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34421380)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33577326
GRCz11 9 33388072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTAGTGTTCGTTTGCTCTGCTGTTTCGCTGACCTTTATATCTTAYTAC[A/T]GAAAGAATCCCCTTCCACATCCAGACAGTCCCCTGCTAATGGCCATTCCA
Long Flanking Sequence:
ATCCTGCTGGACCAAAAGGCCTGGCTCAAACACTACCGCACACCAATTTCGCAACCAAGATACCGGAACCCTCCCTTAAATATTAGCATTTTTAAGGGGAGCTTAGATGTACAATCGACAGGGTTTACAATCGACAAGCAATCAGCGTAATCAATCTGTACCACATTGGGTACAGACATACTATAACTTTTTTAGTTTTGCACTTAATTATGAATAAAGAGTGCTCATATTTCACCTACAATTAAACAGTACATATCTGAAGGAAGATGTTTACACAGAGAGAGATGTGTTGGCTCCTCCTTGTGGTGGGAAGCTGCAGTTGCGGCATCATGTTTCCTTTGCGCAGCTGTAACATTACTGTGCTTTTAATTGTCCGTACAATAACTTTGATCTCTAACAAATCTTTTGGTTTCCCTTACATTATGTCCCCAAGCTTCTTACTGATATGTTGGCTAGTGTTCGTTTGCTCTGCTGTTTCGCTGACCTTTATATCTTATTAC[A/T]GAAAGAATCCCCTTCCACATCCAGACAGTCCCCTGCTAATGGCCATTCCAGCATTAACAGTTCTATCTTGGTAAGGATCCAAGACAACTTCAAATAACGACCCCTCTTCCCACCCCCCAACAATGTCCTAATGTTGTCTATGATTATTTCACCCCGTTCTTGCAATCATACCCTCCTAATTTGCACTAAATGTTATTAAATTTGTTATGTTTTTTTTTTGTTTTTACTGTTTAGTTTTTTTCTCAAAGTTTTAGTTTTGATCTCAAACTCAAAGCCACTCATTATGTATAGTTTCCGTTATCTCTGTTCACAAATTGGTGTGCTCTGTGCTGCTGTATCCCACTTATTATGACTGCCAGTGTGACTGCTCTTTCTGACGGCACACTGTACAGTGAACGCGGGATCTACTATTCACTTACATATTCCTGTTAAAGAAAGTGATGCATATTTACTGACAGTGGGAGCTTTGATTAGACTAAACTCGGTGGAGGCATGCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11434
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 577 899 None 27
ENSDART00000100849 Essential Splice Site 583 907 None 26
ENSDART00000144150 Essential Splice Site 577 901 None 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34421308)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33577254
GRCz11 9 33388000
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGACAGTCCCCTGCTAATGGCCATTCCAGCATTAACAGTTCTATCTTGG[T/C]AAGGATCCAAGACAACTTCAAATAACGACCCCTCTTCCCACCCCCCAACA
Long Flanking Sequence:
CCCTTAAATATTAGCATTTTTAAGGGGAGCTTAGATGTACAATCGACAGGGTTTACAATCGACAAGCAATCAGCGTAATCAATCTGTACCACATTGGGTACAGACATACTATAACTTTTTTAGTTTTGCACTTAATTATGAATAAAGAGTGCTCATATTTCACCTACAATTAAACAGTACATATCTGAAGGAAGATGTTTACACAGAGAGAGATGTGTTGGCTCCTCCTTGTGGTGGGAAGCTGCAGTTGCGGCATCATGTTTCCTTTGCGCAGCTGTAACATTACTGTGCTTTTAATTGTCCGTACAATAACTTTGATCTCTAACAAATCTTTTGGTTTCCCTTACATTATGTCCCCAAGCTTCTTACTGATATGTTGGCTAGTGTTCGTTTGCTCTGCTGTTTCGCTGACCTTTATATCTTATTACAGAAAGAATCCCCTTCCACATCCAGACAGTCCCCTGCTAATGGCCATTCCAGCATTAACAGTTCTATCTTGG[T/C]AAGGATCCAAGACAACTTCAAATAACGACCCCTCTTCCCACCCCCCAACAATGTCCTAATGTTGTCTATGATTATTTCACCCCGTTCTTGCAATCATACCCTCCTAATTTGCACTAAATGTTATTAAATTTGTTATGTTTTTTTTTTGTTTTTACTGTTTAGTTTTTTTCTCAAAGTTTTAGTTTTGATCTCAAACTCAAAGCCACTCATTATGTATAGTTTCCGTTATCTCTGTTCACAAATTGGTGTGCTCTGTGCTGCTGTATCCCACTTATTATGACTGCCAGTGTGACTGCTCTTTCTGACGGCACACTGTACAGTGAACGCGGGATCTACTATTCACTTACATATTCCTGTTAAAGAAAGTGATGCATATTTACTGACAGTGGGAGCTTTGATTAGACTAAACTCGGTGGAGGCATGCAAGATTGTGGCTAGGCATGTAGGATTCCTTGCATCCTACTATTCCTAGCATGCATACTGCCTAGCTAATCCAGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3721
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040843 Essential Splice Site 813 899 25 27
ENSDART00000100849 Essential Splice Site 821 907 24 26
ENSDART00000144150 Essential Splice Site 815 901 23 25

The following transcripts of ENSDARG00000059809 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34403656)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33559602
GRCz11 9 33370348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAAATCCATGAGCAGGGACTCATAGCCATACTGGACGTAGAGCCACAG[G/A]TGAACGTTTAGAGATTTTTAATGAGAGAAGTTGCTCATACAGTAACCTTG
Long Flanking Sequence:
GGTAGTGAAGTTGCCGGCGTTCAAGAGGAAAACATTAGTTTTACTAGGTGAGTATGTTGATCAGAGTTCTTAATCATTGCTTGTTGTCATAAAGCACACGTCTCTTACATTCATGGTTTGTTGCTGACCGGCAGGTGCTCACGGTGTTGGCCGAAGACACATCAAGAACACACTCATCACCAAACACCCAGACAGATTTGCTTATCCCATTCCACGTAAGCAGCTTTCTCAAAATCTTTATTATTGTGCACCAGTCCTGATCAGTGGGTAAACACAAACTTATTTCTGCTCCAAAAGACACAACCAGACCTCCAAAGAAAGATGAAGAGAACGGCAAGAATTATTTCTTTGTTTCACATGACCAAATGATGCAGGACATCTCCAACAACGATTACCTGGAGTACGGCAGCCACGAGGACGCGATGTACGGCACACGGCTGGAGACGATACGCAAAATCCATGAGCAGGGACTCATAGCCATACTGGACGTAGAGCCACAG[G/A]TGAACGTTTAGAGATTTTTAATGAGAGAAGTTGCTCATACAGTAACCTTGTTGATCATTTTAGCTATGCAATACCATTAATGGATTTCCAGAAATATGCTTTGGTTTTTGGTGTTTATTTCAAAGACCTAGATTTTGTGATCAGCAACACAAAGGCGCTATGGGGTTTTCAGCACAGCACAGCAACACTCTTTATGCTGGCTTAAGAATGTAATGCATTCCTTAGTCTTGTGTTGTTTGATTCTCTTCAGGCACTGAAGGTTTTACGGACAGCTGAATTTGCTCCCTATGTGGTTTTCATAGCTGCACCAACTATCACTCCTGGCATGAATGAGGTGAGATCAGAATCCAAAATACATGGACTTCTCAAAAGGCCACGGCATGAGTCACTTCACTGGCAGAATAACTCCATCTAACTTCTTTCCTTCTTTGTCTTCAGCTGATCTGTTTTCTGTTTTGCATGCATCGTGTTTTAGCATGTATTTTAATTTCTTCTACCTT
Associated Phenotype:
Not determined