Busch Lab

ZMP

si:dkey-3h3.1

Ensembl ID:
ENSDARG00000059801
ZFIN ID:
ZDB-GENE-060526-297
Description:
Novel protein similar to murine PDZ domain containing 3 (Pdzk3) [Source:UniProtKB/TrEMBL;Acc:A2BGF8]
Human Orthologue:
PDZD2
Human Description:
PDZ domain containing 2 [Source:HGNC Symbol;Acc:18486]
Mouse Orthologue:
Pdzd2
Mouse Description:
PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922394]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa20503 Nonsense Available for shipment Available now
sa33673 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40523 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33672 Nonsense Available for shipment Available now
sa33671 Nonsense Mutation detected in F1 DNA Not yet available
sa45221 Nonsense Mutation detected in F1 DNA Not yet available
sa18816 Nonsense Mutation detected in F1 DNA Not yet available
sa12538 Nonsense Available for shipment Available now
sa12548 Nonsense Available for shipment Available now
sa20502 Nonsense Available for shipment Available now
sa11937 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20503
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 None None 2251 None 23
ENSDART00000125512 Nonsense 6 178 1 2
ENSDART00000135030 Nonsense 6 914 1 15
Genomic Location (Zv9):
Chromosome 5 (position 42668257)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40449522
GRCz11 5 41049675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTGGCCCAGACAGGCCCAGGAGCAGCAGCTAAGATGCCTATCACCCAA[G/T]AAAATGCCCTGAGCCATCTCCTCCTGCTGGAGAATTGGCTTAGGGCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33673
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 None None 2251 None 23
ENSDART00000125512 Essential Splice Site 167 178 2 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42667481)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40448746
GRCz11 5 41048899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGTGCACTAAATCTGTCCCTCCTTTTTCATTATGTGAAGTTATTTGA[G/A]TGTACTTGGACATCTTGTACTTGTACATCCAGGCAGTGACTGTGTTTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2203
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 2 2251 1 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 Nonsense 184 914 2 15
Genomic Location (Zv9):
Chromosome 5 (position 42623446)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40404711
GRCz11 5 41004864
KASP Assay ID:
554-2530.1 (used for ordering genotyping assays)
KASP Sequence:
WTACTTGGCGGACCARTGCTGGAATGGAGGCTGCATCTACCTGATCATGT[T/A]GCGCAGAATCAAACGCAAGGCTCCTCTCCCTCCATGCAATGGCAGCAACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40523
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Essential Splice Site 461 2251 8 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 Essential Splice Site 709 914 10 15
Genomic Location (Zv9):
Chromosome 5 (position 42589263)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40369152
GRCz11 5 40969305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCATTTTCCCCAATGGAGCAGCTGCAGCAGACGGGAGACTGAAAGAAG[G/A]TAGATGGACAATCCTGATCATAAAAAAGTCACTCTAATGCACTTGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33672
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 658 2251 13 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 Nonsense 906 914 15 15
Genomic Location (Zv9):
Chromosome 5 (position 42579855)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40359729
GRCz11 5 40959882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGGTGTCTGAACAGGAGATGGATGAAGTGATCACTCGTTCCACACAT[C/T]GAGATAGTCATTCTTCTCACACACTCGGTAAAATGCATGTTTTGTCTTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26538
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 702 2251 15 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42578452)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40358326
GRCz11 5 40958479
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTGATTTCCCCAAAGATTTGATTTCATGTCTCCATCTGTCCCTGCAG[C/T]AAGGCTCATTGAGTTCAGAGGCAGAGCTCTCTCAGTATTTCACGGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33671
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 953 2251 16 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42577598)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40357472
GRCz11 5 40957625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCACAAAGCTGTGACTCGTGTCAAGAGCATGATGAGCATTGAGTG[T/A]CCAAACCCTCCACAAAGAACCAAGGGGGAAGATCCAGCTTTATTCCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 1071 2251 17 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42576054)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40355928
GRCz11 5 40956081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAACAATTGGTGACACCCCCGTGTGCACATCCTCCTATCAGGAGATCTG[T/A]GACCTCATGCACAACCTGCCAATCACATTGACCTTAGAGATTAAGAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18816
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42572870)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40352742
GRCz11 5 40952895
KASP Assay ID:
2259-6309.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATAGTTACTCAAGGAACTTTAGTAATCTGGGAGAGAGCATTGTCCCAT[T/A]ACAGAAAGGAGATGGACATAAACCTAGTATGTACAGTATGGTGGATAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42572870)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40352742
GRCz11 5 40952895
KASP Assay ID:
2259-6309.1 (used for ordering genotyping assays)
KASP Sequence:
AAATAGTTACTCAAGGAACTTTAGTAATCTGGGAGAGAGCATTGTCCYAT[T/A]ACAGAAAGGAGATGGACATAAACCTAGTATGTACAGTATGGTGGATAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12548
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
ENSDART00000083515 Nonsense 1227 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42572870)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40352742
GRCz11 5 40952895
KASP Assay ID:
2259-6309.1 (used for ordering genotyping assays)
KASP Sequence:
AAATAGTTACTCAAGGAACTTTAGTAATCTGGGAGAGAGCATTGTCCYAT[T/A]ACAGAAAGGAGATGGACATAAACCTAGTATGTACAGTATGGTGGATAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 1749 2251 18 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42571304)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40351176
GRCz11 5 40951329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATAAAGATGCTGCTTCTAATCTCAAAACAAGCAAATCCAAGCTGTATT[T/A]AAGAGGACTAGACCGCCGAAGCTGCTCTACAGATGCTGGTGGATCTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11937
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083515 Nonsense 2226 2251 23 23
ENSDART00000125512 None None 178 None 2
ENSDART00000135030 None None 914 None 15
Genomic Location (Zv9):
Chromosome 5 (position 42556866)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40331583
GRCz11 5 40931736
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RATGAGCTACTAGCCATCAAYGGCAGGTCTTTGCAGGGTCTTATGCAYTA[T/A]GATGCCTGGAACATCATCAAAAGCGTCTCTGAGGGTCCGGTTCAGTTAGT
Associated Phenotype:
Not determined