Busch Lab

ZMP

A0PJS2_DANRE

Ensembl ID:
ENSDARG00000059784
Description:
LOC798528 protein [Source:UniProtKB/TrEMBL;Acc:A0PJS2]
Human Orthologue:
DENND4B
Human Description:
DENN/MADD domain containing 4B [Source:HGNC Symbol;Acc:29044]
Mouse Orthologue:
Dennd4b
Mouse Description:
DENN/MADD domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2446201]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10314 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10314
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083464 Essential Splice Site 434 1473 8 27
ENSDART00000114726 Essential Splice Site 434 704 9 15
Genomic Location (Zv9):
Chromosome 16 (position 58250362)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54772069
GRCz11 16 54577535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCGCTGCGGCCYGACGTGCTGACGTCTGTGAGTGAAGCACTGCTGTCGG[T/G]GAGTCCCCAGCYCAGCTCAGCTCACACACACAGATCAGATTAGACACTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28766
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083464 Essential Splice Site 800 1473 16 27
ENSDART00000114726 None None 704 None 15
Genomic Location (Zv9):
Chromosome 16 (position 58242660)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54779771
GRCz11 16 54585237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCTCTAATATTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGC[A/G]GGTGTGTTACCGTATCCTGATGCAGCTGTGTGGTCAGTACGGTCAGCCTG
Associated Phenotype:
Not determined