Busch Lab

ZMP

gpatch8

Ensembl ID:
ENSDARG00000059768
ZFIN ID:
ZDB-GENE-030131-6966
Description:
LOC565404 protein [Source:UniProtKB/TrEMBL;Acc:A4QP17]
Human Orthologue:
GPATCH8
Human Description:
G patch domain containing 8 [Source:HGNC Symbol;Acc:29066]
Mouse Orthologue:
Gpatch8
Mouse Description:
G patch domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1918667]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa769 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa769
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108937 Nonsense 914 1431 11 12
Genomic Location (Zv9):
Chromosome 3 (position 37661303)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37524663
GRCz11 3 37666521
KASP Assay ID:
554-0674.1 (used for ordering genotyping assays)
KASP Sequence:
AGTAGTCGCAGCTCCAGTCGAAGTAGTTGGAGTAGCAGTGCTCGTTCTTA[C/A]AGACGCAGTAGCTACAGTCGCAGCCGTAGCTCTGCTAGTCGTTCATCTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26125
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108937 Essential Splice Site 1348 1431 11 12
Genomic Location (Zv9):
Chromosome 3 (position 37659999)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37523359
GRCz11 3 37665217
KASP Assay ID:
2259-3857.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACCACATACCTCAACATCACCTAACCCCTATCTCCTTGTCGCCATTGG[G/C]CCATTCTTTGGGCCATTCACTTGGTCACTCTTTAGGACACACTGGCCTGA
Associated Phenotype:
Not determined