Busch Lab

ZMP

si:dkey-170o10.3

Ensembl ID:
ENSDARG00000059759
ZFIN ID:
ZDB-GENE-060526-218
Description:
Ubiquinone biosynthesis protein COQ4 homolog, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:A9JR86]
Human Orthologue:
COQ4
Human Description:
coenzyme Q4 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:19693]
Mouse Orthologue:
Coq4
Mouse Description:
coenzyme Q4 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1098826]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26597
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083413 Nonsense 19 274 1 7
ENSDART00000132341 Nonsense 20 285 1 7

The following transcripts of ENSDARG00000059759 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 63024106)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53777070
GRCz11 5 54423663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGTTACCGGGTGCTTTCCTTGGTTCTTTTAAAACCTCTTACGGATATT[T/A]AAGTCAACGTTTATACGGAGGTATTTTAATTTAAAAAAATTAGTTCCCTA
Associated Phenotype:
Not determined