Busch Lab

ZMP

nol6

Ensembl ID:
ENSDARG00000059711
ZFIN ID:
ZDB-GENE-030131-6294
Description:
nucleolar protein family 6 [Source:RefSeq peptide;Acc:NP_001154983]
Human Orthologue:
NOL6
Human Description:
nucleolar protein family 6 (RNA-associated) [Source:HGNC Symbol;Acc:19910]
Mouse Orthologue:
Nol6
Mouse Description:
nucleolar protein family 6 (RNA-associated) Gene [Source:MGI Symbol;Acc:MGI:2140151]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa841 Essential Splice Site Available for shipment Available now
sa12332 Essential Splice Site Available for shipment Available now
sa38501 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa962 Essential Splice Site F2 line generated Not yet available
sa40553 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa26570 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa7003 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38502 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa841
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 191 1153 4 26
ENSDART00000128402 Essential Splice Site None 444 4 28
ENSDART00000083294 Essential Splice Site 191 1153 None 26
ENSDART00000128402 Essential Splice Site None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52558712)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50225908
GRCz11 5 50872501
KASP Assay ID:
554-0744.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCATCAARCCCAGAGTCTRTGTGGACCTTGCTGTCATCATTCCTTCTG[T/G]AAGTTATATGTTCTACTTGTCTTTTTTTCCNNNNNNNNNNTGTCTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12332
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 191 1153 4 26
ENSDART00000128402 Essential Splice Site None 444 4 28
ENSDART00000083294 Essential Splice Site 191 1153 None 26
ENSDART00000128402 Essential Splice Site None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52558712)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50225908
GRCz11 5 50872501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCATCAARCCYAGAGTCTRTGTGGACCTTGCTGTCATCATTCCTTCTG[T/C]AAGTTATATGTTCTACTTGTCTTTTTTTCCNNNNNNNNNNTGTCTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38501
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 293 1153 None 26
ENSDART00000128402 Essential Splice Site None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52562425)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50229621
GRCz11 5 50876214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAATGTAAAGACTGAATGGTTTACTGGTGTTGCAAAGGAGGAGCAAGG[T/C]AATATGGAAATATGTGAGGTCAATCATTTTAGGGGCTGTTTACACCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa962
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 630 1153 14 26
ENSDART00000128402 Essential Splice Site 197 444 14 28
Genomic Location (Zv9):
Chromosome 5 (position 52572148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50239344
GRCz11 5 50885937
KASP Assay ID:
554-0867.1 (used for ordering genotyping assays)
KASP Sequence:
GTGACAAGAGGCTCRTGCTTCTGGAGATCATCACTCACCTGCTACATCTG[T/G]AAGTGTCTGTTCTGTGCATATAAATCCACTTTAATACATTATAGCATAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40553
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Essential Splice Site 655 1153 15 26
ENSDART00000128402 Essential Splice Site 222 444 15 28
Genomic Location (Zv9):
Chromosome 5 (position 52572404)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50239600
GRCz11 5 50886193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATTTGTTGGTGGACAACTGGATGATGTCATTAAAGTTAACAAAGAGG[T/C]ACTCCATGAACCAAATGCGTTAATAAATAAATGTGTGTGAGAAAAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Splice Site, Nonsense 702 1153 16 26
ENSDART00000128402 Splice Site, Nonsense 269 444 16 28
Genomic Location (Zv9):
Chromosome 5 (position 52572644)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50239840
GRCz11 5 50886433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTGTCCATCACATCAGTCCAGGGTGCCCACCAGGCCTTAAGATACACA[C/T]AGGTTAGCAGCCACCTCCTCCGCTGTGTGAATTTGTGTGATTTATTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7003
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 None None 1153 None 26
ENSDART00000128402 Essential Splice Site 364 444 19 28
Genomic Location (Zv9):
Chromosome 5 (position 52575782)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50242978
GRCz11 5 50889571
KASP Assay ID:
554-4994.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTGTCCTAAAAGAGTTATTGAGCACATTATTTATTAATATTTGATGYA[T/A]GCATTCATTYAATCAATTAGGATGGACTAGCCTTCCGTGTTGAAGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38502
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083294 Nonsense 846 1153 19 26
ENSDART00000128402 None None 444 None 28
Genomic Location (Zv9):
Chromosome 5 (position 52575960)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50243156
GRCz11 5 50889749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGCGCTGGAGCTGGAGACCCAACACAAACCTTTCCTCACCAGCACCT[T/A]GCATGGGTATGCTAACATTATCAAGTACAACACAGTTTCTTGATTTAGCC
Associated Phenotype:
Not determined