Busch Lab

ZMP

flii

Ensembl ID:
ENSDARG00000059701
ZFIN ID:
ZDB-GENE-071212-3
Human Orthologue:
FLII
Human Description:
flightless I homolog (Drosophila) [Source:HGNC Symbol;Acc:3750]
Mouse Orthologue:
Flii
Mouse Description:
flightless I homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1342286]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12788 Essential Splice Site Available for shipment Available now
sa9399 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083263 Essential Splice Site 286 1260 9 30
Genomic Location (Zv9):
Chromosome 3 (position 40217351)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40080711
GRCz11 3 40222569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGGAGATGYAAATTATATACTGCCTCTTCTTTTTCCATTTTTAATGCA[G/T]TCTGCCATTTGCAAGCTGTCCAAGCTGAAGAAGCTTTAYGTGAACTCCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6911
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083263 Nonsense 355 1260 10 30
Genomic Location (Zv9):
Chromosome 3 (position 40217061)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40080421
GRCz11 3 40222279
KASP Assay ID:
554-4981.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTGGAAAATTAAAGAAGCTGGTTTTGAACAAGAACCGGCTTGTGACAT[T/A]ACCAGAAGCTATCCATTTCCTCACTGAGCTGGAGGTAAAACTTMATTGTT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa9399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083263 Nonsense 420 1260 12 30
Genomic Location (Zv9):
Chromosome 3 (position 40216048)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40079408
GRCz11 3 40221266
KASP Assay ID:
2259-3917.1 (used for ordering genotyping assays)
KASP Sequence:
ACGAAMAATATGTACACTTTTGTGTGTCTTTGTATACAGGAAATAGCCCA[C/T]GAGACCATATGGCCAGGAAAATGAGGCTRAGGAGATGCAAGGACTCTGCC
Associated Phenotype:
Not determined