Busch Lab

ZMP

agmat

Ensembl ID:
ENSDARG00000059700
ZFIN ID:
ZDB-GENE-060929-696
Description:
agmatine ureohydrolase [Source:RefSeq peptide;Acc:NP_001071019]
Human Orthologue:
AGMAT
Human Description:
agmatine ureohydrolase (agmatinase) [Source:HGNC Symbol;Acc:18407]
Mouse Orthologue:
Agmat
Mouse Description:
agmatine ureohydrolase (agmatinase) Gene [Source:MGI Symbol;Acc:MGI:1923236]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17902 Nonsense Available for shipment Available now
sa17858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17902
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083271 Nonsense 167 366 2 7
Genomic Location (Zv9):
Chromosome 23 (position 37583682)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37382910
GRCz11 23 37485572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGCAAAAAAATACAGGAGGCTTAYCGTAAAATCGTGRCCACCGGCTG[C/A]ATCCCACTAACCCTGGGTGAGAACTRCACAGATATTAAAGKTTTCMGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17858
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083271 Nonsense 243 366 4 7
Genomic Location (Zv9):
Chromosome 23 (position 37584073)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37383301
GRCz11 23 37485963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCTGGACTGCAAGAGGGTTGCCCAGATCGGGCTYAGAGGATCYGGTTA[T/G]TCTCCAGATAATTATGAGTGGAGCCGAGGACAGGTATCATCATGCATTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29987
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083271 Essential Splice Site 314 366 5 7
Genomic Location (Zv9):
Chromosome 23 (position 37586789)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37386017
GRCz11 23 37488679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTCCGGGCACAGGAACACCTGAGATTGCTGGTCTCACACCCATTCAG[G/T]TAGGATTAACCAAGTTATAATGTAGGATTATAATGCAGGATCAATTAATT
Associated Phenotype:
Not determined