Busch Lab

ZMP

NP_001038387.1

Ensembl ID:
ENSDARG00000059692
Description:
sodium channel, voltage gated, type XII, alpha a [Source:RefSeq peptide;Acc:NP_001038387]
Human Orthologues:
SCN10A, SCN11A, SCN5A
Human Descriptions:
sodium channel, voltage-gated, type V, alpha subunit [Source:HGNC Symbol;Acc:10593]
sodium channel, voltage-gated, type X, alpha subunit [Source:HGNC Symbol;Acc:10582]
sodium channel, voltage-gated, type XI, alpha subunit [Source:HGNC Symbol;Acc:10583]
Mouse Orthologues:
Scn10a, Scn11a, Scn5a
Mouse Descriptions:
sodium channel, voltage-gated, type V, alpha Gene [Source:MGI Symbol;Acc:MGI:98251]
sodium channel, voltage-gated, type X, alpha Gene [Source:MGI Symbol;Acc:MGI:108029]
sodium channel, voltage-gated, type XI, alpha Gene [Source:MGI Symbol;Acc:MGI:1345149]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa33047 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15768 Nonsense Available for shipment Available now
sa39947 Nonsense Mutation detected in F1 DNA Not yet available
sa12942 Nonsense Available for shipment Available now
sa25126 Nonsense Mutation detected in F1 DNA Not yet available
sa19899 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3417
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Essential Splice Site 188 1027 3 12
Genomic Location (Zv9):
Chromosome 2 (position 51486816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52315743
GRCz11 2 51908505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGAGATGGCAGATGATGGCATGGATCCAGAAGAGTGTTTTCCAGAGT[G/A]TAAGCAGATAAAATATTCATATTTGTTCTCCTGTGGCTATGACACTTCMT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33047
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Essential Splice Site 339 1027 6 12
Genomic Location (Zv9):
Chromosome 2 (position 51498050)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52305399
GRCz11 2 51898161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTCTGCGACCCCTGAGGGCCCTATCTAGATTTGAAGGAATGAGGG[T/A]AAGATGCTTTCTTCTGTATTTTTCAATTACCTAAACATTTAGTAATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 563 1027 11 12
Genomic Location (Zv9):
Chromosome 2 (position 51504826)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52296978
GRCz11 2 51889740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATAACCATYATGATGCTCATTATCCTCAATATGATAACCATGATGGTT[G/T]AGACTGATGAACAATCTGCTCGCATGGAGACCATCCTCAATAACATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39947
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 647 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51505386)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52296416
GRCz11 2 51889178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTCTCCCCAACTCTTTTTCGAGTCATCCGGTTGGCAAGAATAGGA[C/T]GAGTTCTTCGACTGATACGAGCAGCTAAGGGAATAAGGACTTTACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 728 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51505630)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52296172
GRCz11 2 51888934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCGGGAACAGCATGATCTGYCTTTTCCAGATCACCACATCGGCCGGTT[G/A]GAATAACCTGCTGGATCCTATCCTGAACAACTCTCCGGAAGAGTGTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25126
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 971 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51506358)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52295444
GRCz11 2 51888206
KASP Assay ID:
554-7714.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAAGAGGACAGCGCTCCAGAGCAGGAAGGTCTTATAGCGTCTATGATT[A/T]AAGAGAACTATGGCCCTGAGAAAATGGTGGGTACACTGTGCTATGCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19899
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083256 Nonsense 1023 1027 12 12
Genomic Location (Zv9):
Chromosome 2 (position 51506514)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 52295288
GRCz11 2 51888050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATATCTGACTCTAGATCCAATGAGCCTCATAAATCAGAAGAGACATAC[G/T]AAGAGACCTTTCTTTAGGAACTCTTTTCATAGTAGGCAGTCATTATTTGC
Associated Phenotype:
Not determined