Busch Lab

ZMP

si:ch211-117c19.1

Ensembl ID:
ENSDARG00000059678
ZFIN ID:
ZDB-GENE-060526-15
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPW5]
Human Orthologue:
KIAA1161
Human Description:
KIAA1161 [Source:HGNC Symbol;Acc:19918]
Mouse Orthologue:
AI464131
Mouse Description:
expressed sequence AI464131 Gene [Source:MGI Symbol;Acc:MGI:2140300]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11500 Nonsense Available for shipment Available now
sa9561 Nonsense Available for shipment Available now
sa20537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11500
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 269 663 2 2
ENSDART00000083208 Nonsense 269 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56381290)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51857560
GRCz11 5 52504153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCRATATTTCAACAAGCCCAATAAGRTTCCATCAGAAGCTGTTTTCAAA[C/T]AACCAATCTGGTCTACAGGAGCTCTAGAAGAAGYYAACCAAGAAAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9561
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 269 663 2 2
ENSDART00000083208 Nonsense 269 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56381290)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51857560
GRCz11 5 52504153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCRATATTTCAACAAGCCCAATAAGRTTCCATCAGAAGCTGTTTTCAAA[C/T]AACCAATCTGGTCTACAGGAGCTCTAGAAGAAGYYAACCAAGAAAGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26583
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 360 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56381017)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51857287
GRCz11 5 52503880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCATCCATTTGTCAACTATAATTCTGTCAATTTTGGTGTCGGAGTAGAA[C/T]GAGGACTGTTTGTACGTGTACCTGGTAGCCAACTTCCCGCTTTGGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20537
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083208 Nonsense 597 663 2 2
Genomic Location (Zv9):
Chromosome 5 (position 56380304)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51856574
GRCz11 5 52503167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCATCATTCGCCCTCTTTGGTGGATTGCTACAGATGATGAGGCTGCCTA[C/A]AAAATTGACTCTCAGTTCCTCATAGGAGATGACCTTCTTGTGGCACCTGT
Associated Phenotype:
Not determined