Busch Lab

ZMP

si:ch211-117c19.2

Ensembl ID:
ENSDARG00000059677
ZFIN ID:
ZDB-GENE-060526-16
Description:
MAM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001123869]
Human Orthologue:
MAMDC2
Human Description:
MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
Mouse Orthologue:
Mamdc2
Mouse Description:
MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12046 Essential Splice Site Available for shipment Available now
sa33721 Nonsense Mutation detected in F1 DNA Not yet available
sa40564 Nonsense Mutation detected in F1 DNA Not yet available
sa6065 Nonsense Mutation detected in F1 DNA Not yet available
sa13995 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12046
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Essential Splice Site 11 680 2 14
Genomic Location (Zv9):
Chromosome 5 (position 56445868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51922138
GRCz11 5 52568731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTTAAAGCTTTATAGTTTGGCTTTATTGATGTGAKGTTCTGTSTCTTC[A/G]GCTGTGGCTCTTGTAGCGCGGTCTCAGACGCAGCTTTTGCGGGGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33721
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 87 680 3 14
Genomic Location (Zv9):
Chromosome 5 (position 56424775)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51901045
GRCz11 5 52547638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGTCCGGAGCTGGAGCTCAGAGACTGGAGCTGTGTGCGGCTGGTCTAT[C/T]AGATCTCAGGCTCAGGATCTCTTCAATTGCACTTGCGATCCGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40564
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 336 680 8 14
Genomic Location (Zv9):
Chromosome 5 (position 56403722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51879992
GRCz11 5 52526585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATCACTCATGTTTCAGAGCCAGAGATTGACCCGTCTGTTGCAAACTG[T/A]GACTTTGAGGAGGGCCTGTGTCAGTATTATCAGGAACAGACTGGAGGCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3513
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 519 680 11 14
Genomic Location (Zv9):
Chromosome 5 (position 56390296)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51866566
GRCz11 5 52513159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGACACTGTAACTTTGAAACTGGTGACTGTGGCTACACCCAGAAAAAG[A/T]AAGCTAAAAAAGGACATTGGCTAAGGATTCGAGGACAGACGCCCACATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 538 680 11 14
Genomic Location (Zv9):
Chromosome 5 (position 56390239)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51866509
GRCz11 5 52513102
KASP Assay ID:
554-3846.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAGGACATTGGCTAAGGATTCGAGGACAGACGCCCACATCTTACACC[G/T]GACCCAAGGGGGACCACACCTTAGGGGTAGGTGAGTCAGATTTATACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13995
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083203 Nonsense 554 680 12 14
Genomic Location (Zv9):
Chromosome 5 (position 56390101)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51866371
GRCz11 5 52512964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AKYACACTAAGTTTCTCCTAYTCTGACTTCAAGGTTACTTCATGTACATT[G/T]AGGCCTCCCAYATGTTACCTAAGCAGTCAGCCCAGCTGATGTCCACTGAG
Associated Phenotype:
Not determined