Busch Lab

ZMP

mks1

Ensembl ID:
ENSDARG00000059657
ZFIN ID:
ZDB-GENE-030131-3813
Description:
meckel syndrome, type 1 [Source:RefSeq peptide;Acc:NP_001070841]
Human Orthologue:
MKS1
Human Description:
Meckel syndrome, type 1 [Source:HGNC Symbol;Acc:7121]
Mouse Orthologue:
Mks1
Mouse Description:
Meckel syndrome, type 1 Gene [Source:MGI Symbol;Acc:MGI:3584243]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20540 Essential Splice Site Available for shipment Available now
sa40567 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7574 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20540
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Essential Splice Site 26 559 1 18
Genomic Location (Zv9):
Chromosome 5 (position 57527920)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55448519
GRCz11 5 56118736
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAATCGGTTTACCGTTCCAGGGATGCAGTTAAAAACTTCCGAATACGG[T/G]AAGACACGTCGCCTGTGTGCATGTATAACAAACTGATGTATATATTTTAA
Long Flanking Sequence:
TGCGACATAAGGAAACTAAATAATCGACCGTGTTTAACAAACATGTGGAACAGCTTTCAGTTTGTTGCCAGTGGGTGACAGGAAAAGTAAATGTGTTACCGCTTGCAGATCAGTAGTGAGCACCGGTCATTTATCAGAAGTTCGATCTCAAAGCAGCACAGGCTGATTTGAGAACAGCATATGTTTGCCAGTACTGAGCATGCGTGCATATGGCTTCCGGCCGCTTCCGTTTTAGATTGTTACTATGCAACAAGACGCTCTGATGTGTGGCGTTAACTGTTTTCAGCAGTATTGCATTCACGAGTGAATTATATCAAAACATTTTAAGCTGCCTTAGTCTTGATGTGAGTGTTTTTATAGTAACCGGTGGGAGTTCTACACTATATGTGAAGACTTTTATCTTTTGACGCTGTGTGTCAGATATGGCTGACGGCTGGTGCTCTGACAACGGAGAATCGGTTTACCGTTCCAGGGATGCAGTTAAAAACTTCCGAATACGG[T/G]AAGACACGTCGCCTGTGTGCATGTATAACAAACTGATGTATATATTTTAAAGCATTATGAACTATTTTGGACACGGTACTGTGGTGTTGTTTTGGAAGAGCTGTGAAAATACCACAGTAAATTAAAGGGATAGATAGTTCCCCTAAAACTGAAAACTCTGTCATCATTTACTCGCCCTGCTTTTTTCAAACCTTTTCTTTAAGTTTCTTTATATTGCTGAACACAGTAATTCTTCAAAATAGCTTCTCTTCTATAAAAAAAGAAATACTTGAGGCTGAGTAAATACATTAGAAATTGTATCCCTTTGAAAACTATCCCTTTAAATTTTACTTATTTCTATATTATATCAGAGTAACATTGTATTGCATACATCATTACTCTGTGATTTTGTTTAGTTTAGTTTATTTCTCAGTGTACATTAATCATTCACCTAGAACGTAAATATACTTATATTAACCCAAAGACTAGTTTTCATTATTAAGGTAAAGTTGGTTTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40567
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Essential Splice Site 67 559 2 18
Genomic Location (Zv9):
Chromosome 5 (position 57525530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55446129
GRCz11 5 56116346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGAGGAGTTATAGAGTTGGAAACCTTCAGCACTCAGACGGCCTCCTG[T/A]ATGTCAAAGACAGATATTAACCTGATAAAGGGATGGCTCACACAACAATG
Long Flanking Sequence:
GAATTTCCAATAAACCTAAAATTACCTATATTCAATTTGACCTTGTTACATACCTTTTTATATGTGTTTTAAAACCAAGACAGGAGTCCAGACAAACCCATAGGTATTTACACTCTGTGACATCTTGAACTTTCTCTCCTGAGATAACAACATCCTGTTTTGTTTCAATACGCATGTACTTCTCTAAATGACATGAAGCTATTTTTGACACATTTAATTTTGTGAAACTGCAACTGTTTTTTTGTAAAAGTTTTCACAATGATTCTGTATAATAACTAAATCAATAGTGCTGTGTTTACATGGTATTCAAACATTACTAAAACTAAGCCACTGTAAAACATTGTATCACCTTGTTACTTTTACTGTTTCTGTTTCAGAGTGCGCATTCAGCGTGTGACCTCCACAGCAGCCCTGTCTGAACACCTCCATCAGCAAGTGCTTTCTCAGCAGGAGAGAGGAGTTATAGAGTTGGAAACCTTCAGCACTCAGACGGCCTCCTG[T/A]ATGTCAAAGACAGATATTAACCTGATAAAGGGATGGCTCACACAACAATGAGAATTTGCTATTTATTTACTCACTCTTTAGACCTAATTCAAATGCTTATTACGGTTTAGATTATTTTCTTACTTTTTAAAAAATACATACAATATATATTTTTAAATATCTATTGGATAGAACAGTAGAGAGTGTAGAGTAATCCATGGGGAGCAGAGAATGGGGAAGAATTAGTAAAGAACCTTGAGCCAAGAATTGAGCAAATCAATGCTATGTGCCAATACACTTAAAGAGCCCTATTTTGCATTAAGAAAGGTCATATTTGGTTTTGGGTTCTCCAACAACAGGTTGATATACATGCAAGGTCAAAAACACTTTGATTGTCTTATAATATGCATTTTTTTACCTAATTATCCCAACGACTCCCATATGATTTGTTCAGTGATTCATTTGTTCCCAAACCCCTCTTTAGCATGAGGTTAATCTGCGCTGATTGCTGCAATGACCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26587
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Nonsense 220 559 7 18
Genomic Location (Zv9):
Chromosome 5 (position 57519513)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55440112
GRCz11 5 56110329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCAACTCACTTAACTATTTTACAGGTTGGGCCTGAAAGAGAATGAATA[T/A]GTTTTATGCACAATAAAAGCGGACGGCAATGGAGTAATCTCAATAAAACC
Long Flanking Sequence:
AGTGGAATGAAACACCAATTACTCCGGCATTATTATTATTTAATTTTTATTTATTTATTATTATTTTGTTTGTTATATAGAGAGTCGAATGTTCCCAAGTCCCGTTTAATCACATGGGAACCTTCAGAGGAGTTTGTGAAGAACAGTCACATCATCAACACGCCAGTGCAGACCATGTACATCATGGCTGATCTTGGACCTACAGGAAAGTATGTGAGACAATGCTTGCCATTTAAAGAAGCCATATCATACAATTTTCTAGAATTTAGTTGACCTGAGGGGCCACTTATTACACTACTTAAGGGCTTTGCTTTCACACTGTGTAGTTTAAAGTCACCATTTTCCTCTTCAGCTGTAAGACTTTTGTCCACATACCCTGTATATGTCACACAACAGACACTTGCATGTGAGTTATAGTCATAGATTGGTGTATTTTCTATAGAACAACACAATCAACTCACTTAACTATTTTACAGGTTGGGCCTGAAAGAGAATGAATA[T/A]GTTTTATGCACAATAAAAGCGGACGGCAATGGAGTAATCTCAATAAAACCAGACTTTAACAACAACAGAGGAGCCTACAGGCAAGACCCACCTCTGTTCTCTTTCTATTCACTTTTCTGGAGAAGTACATGTTTGAATTCACCGTGATTACAGATGTTTCTGACTATCATTTACACCAGGCTGGAAACAGAGGGGGAGAAGAGGGAAGTGTGGAGGTTGTATCTGGAGAACGCCTCATCAGACATTCAAGCAGAGGAGAAAGACAGAGAGCAGCGCATGTACCGAGATGTAAGTACTATAATATGCATTGATTGTCAAAATGCATGTAATATTATGACTTTAGGTTCTGGTCAATATTTTCAATTTCATTTTATGAAGTTATGAGATGCTAAAACTGAAAAAAAGAGCTAAGTAGACATATAAAAATAAACTCATAACAGCAAATAATTAATTACCTTAAATAACTGAAAATATAGAATAATTTTATATTGTATTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7574
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083134 Missense 531 559 18 18
Genomic Location (Zv9):
Chromosome 5 (position 57500295)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55420894
GRCz11 5 56091111
KASP Assay ID:
554-4208.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTAAAAATCTGCTGTTTGTTTGTGATTTTTCAGAAGCGTTTCAGAGGG[C/A]CCATAAGCGCATGCARGAGGCCAGAGAGACTTTACCCAGAGACCTCATCA
Long Flanking Sequence:
ATATAATATAATATAATATAATAATAACATCACTTCTTTTTTTTCAAAGTTCAGCTCTCTTTCAGACTAAACTGTTTCAGGAATTTCAATACAAAAGGAAAAAAAAAGTTTTTGTTTTGTTTTTGTTACATTAATATTGGATTATTATCCCTTTACAGCCATATCCTGTACAGTTTTGTTGTCTGAGTGGCAGTCGTTTTGAACTAAAATGGTCCTATGGTCCACTCCACTGGACATGCTGTAAAATTAAAAATTAAAACAAAATGTAAACACTCTAAATTGGAGAATTTTTTTAACCCAAAGGATCTAGGAAACCACAGAAAAAAAAAGAAAAAGAAAAAAAATTCGGGTCTCAGAAGGATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATTACAACAGTACAGAATAGCAACATGTTTCTAAAAATCTGCTGTTTGTTTGTGATTTTTCAGAAGCGTTTCAGAGGG[C/A]CCATAAGCGCATGCAGGAGGCCAGAGAGACTTTACCCAGAGACCTCATCAACACGTCTGCACTATTAAACTCAGAGTCTTCTGCTTAGGAACATCAAAACTGATAAAACATATGTAATAATGCTGGTCATGGTATTTGTTTATATGTATAATACTTTTTTGTTGATTTTTTTTTAGTTAAGCTCTGAGAAAAGAAACTAGAAATTAGTAAAGCTCCCATGTTAGTGAAGACCTAATAAAGACTTAATAAACTTAATAAAGACATGGCTATTGAATTATCCTAAACTGCTTAGTTAAAAGTGTTTTCTAAGTACATGTACCATGTTGATAAGTGAAGTTTATTCATAAACTAATTTCGAGAGGAGCACGTGATTATGATTGAACACGGCTGGTTCTGCATTAGCATGCTTGATCTACCAATCAGGCCATTCCTAACCACTATAAAGAGCCAGTGTTTTTCCACTACAGTCATCTTCGATTTGAAGAATACCCCCTTCCACC
Associated Phenotype:
Not determined