Busch Lab

ZMP

ntrk2b

Ensembl ID:
ENSDARG00000059645
ZFIN ID:
ZDB-GENE-010126-2
Description:
BDNF/NT-3 growth factors receptor [Source:RefSeq peptide;Acc:NP_001184090]
Human Orthologue:
NTRK2
Human Description:
neurotrophic tyrosine kinase, receptor, type 2 [Source:HGNC Symbol;Acc:8032]
Mouse Orthologue:
Ntrk2
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39 Nonsense Confirmed mutation in F2 line Not yet available
sa17771 Essential Splice Site Available for shipment Available now
sa17691 Essential Splice Site Available for shipment Available now
sa8981 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13660 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002966 Nonsense 214 792 8 21
ENSDART00000108513 Nonsense 223 238 6 6
ENSDART00000135885 Nonsense 278 854 6 18
Genomic Location (Zv9):
Chromosome 5 (position 57041380)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54961978
GRCz11 5 55632195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGATATGTAACGCATCAGGTTCCCCGACCCCAGAGCTCACTTGGACCT[T/G]AAATTCCAGCGAACACCCTCCTCTCTCAACCAGCCACGAGGTAACACTCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17771
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002966 Essential Splice Site 376 792 12 21
ENSDART00000108513 None None 238 None 6
ENSDART00000135885 None None 854 None 18
ENSDART00000002966 Essential Splice Site 376 792 12 21
ENSDART00000108513 None None 238 None 6
ENSDART00000135885 None None 854 None 18
Genomic Location (Zv9):
Chromosome 5 (position 57058229)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54978839
GRCz11 5 55649056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTATCTGACATACTGTAAAAATTTCCTTGCTCTRTTAAACACCAATA[T/A]AATAATTCTGACACCAACTGTATAATGCAGTTCCTGACACATTCAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002966 Essential Splice Site 376 792 12 21
ENSDART00000108513 None None 238 None 6
ENSDART00000135885 None None 854 None 18
ENSDART00000002966 Essential Splice Site 376 792 12 21
ENSDART00000108513 None None 238 None 6
ENSDART00000135885 None None 854 None 18
Genomic Location (Zv9):
Chromosome 5 (position 57058229)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54978839
GRCz11 5 55649056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTATCTGACATACTGTAAAAATTTCCTTGCTCTRTTAAACACCAATA[T/A]AATAATTCTGACACCAACTGTATAATGCAGTTCCTGACACATTCAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8981
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002966 Essential Splice Site 497 792 17 21
ENSDART00000108513 None None 238 None 6
ENSDART00000135885 Essential Splice Site 559 854 14 18
Genomic Location (Zv9):
Chromosome 5 (position 57079423)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55000022
GRCz11 5 55670239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACTGTTAGTGTTTTAGTATTCATGTGTTTTATTATTCATTATTTTGCA[G/A]TTGTCCAACATATAAAGCGTCACAACATTYTACTGAAGAGGGAGCTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13660
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002966 Nonsense 725 792 20 21
ENSDART00000108513 None None 238 None 6
ENSDART00000135885 Nonsense 787 854 17 18
Genomic Location (Zv9):
Chromosome 5 (position 57095848)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55016447
GRCz11 5 55686664
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGGGTGTAGTACTCTGGGAAATCTTCACCTATGGCAAGCAACCCTGGTA[T/A]CAGCTCTCAAACAATGAGGTAAGATGCTACCCAATCAATCATTTGTCTGA
Associated Phenotype:
Not determined