Busch Lab

ZMP

MTMR14

Ensembl ID:
ENSDARG00000059642
Description:
myotubularin related protein 14 [Source:HGNC Symbol;Acc:26190]
Human Orthologue:
MTMR14
Human Description:
myotubularin related protein 14 [Source:HGNC Symbol;Acc:26190]
Mouse Orthologue:
Mtmr14
Mouse Description:
myotubularin related protein 14 Gene [Source:MGI Symbol;Acc:MGI:1916075]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33865 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26740
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083085 Nonsense 113 630 3 19
Genomic Location (Zv9):
Chromosome 6 (position 23404248)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19659694
GRCz11 6 21719916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTAAAATGGCTCGTTGTAGAGGAAGATTTGTCTGCCCTGTCATCCTCTA[C/A]AATGGAAAGGTAACTATCTTGTCGCCCCAATTCAATTTTCACTGCAGTAT
Long Flanking Sequence:
AAAAAAATTCAAAAGGGGGCTAATAATTCTGACCTCAAGTGTATATGCACAAATACAATACATTTTTAAAAATATAAAAAATATTCCTATAGAAATATTACATTTTTAATAGGAATTTTAAAAATATTCCTATTAAAAATATGAATGTAAAAGATAGATTTGTGAGGGGTGTACTCATATATGCTGAGCATTGTATACATCCTATCGTTCTAAAACTACAAATCATAATCTGAAGACATGTTTTTGGTATAAGGTGTATGCTTATATTATGACTATTTTTTATTGTACAAGTGGGCAAAATTCTTGACTGATCTTGTAAACAAATGGTAAAATATCAGCTGATATGCTGGTCTCTCACTAGTTAAAAAAAAACTCCCTTTTTCTTATTTTTCCTCCCCCAGTTTTGAGAGTACAGTGCAGATCAGTAAGCTGCAGGATCTGGTGAATCGCAGTAAAATGGCTCGTTGTAGAGGAAGATTTGTCTGCCCTGTCATCCTCTA[C/A]AATGGAAAGGTAACTATCTTGTCGCCCCAATTCAATTTTCACTGCAGTATTTGCAACATAGTATCGCTTTAGACCGCCAGATGCTTTCTATTGCTTTGCATTGCTGATGTAATAAACTGCTGATATTTTTGTCGGACATGCCCATAAAATATATTGATAGATAATTCACAGAATCAATAACAGATTGAATCTTTTCTTGTGAAATCTGGCTGTCGGGATTCTTTAGTACTGAAGTGTTGAGTTCTGGACTCAGCCTTTGAATTTAAAGGTTGGTATAATTTACTGGGAGATTCAAAGCAGTTTCCAGTCTCCTCTGTAGTTAGCTTTTCCAGGGGCACTTTTTTCAGATTTGTGGTTTTGTTTTGGCAGCCCTAAACTCTTATTATTACTCTTGTGTTGTAGCATGTGTGTCGATCCTCTACACTAGCCGGTTGGGGTGAACTTTATGGACGCACTGGATACAATTACATTTTTTCAGGTACACTTTCAGCTCTGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33865
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083085 Essential Splice Site 116 630 3 19
Genomic Location (Zv9):
Chromosome 6 (position 23404238)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19659684
GRCz11 6 21719906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGTTGTAGAGGAAGATTTGTCTGCCCTGTCATCCTCTACAATGGAAAG[G/A]TAACTATCTTGTCGCCCCAATTCAATTTTCACTGCAGTATTTGCAACATA
Long Flanking Sequence:
AAAAGGGGGCTAATAATTCTGACCTCAAGTGTATATGCACAAATACAATACATTTTTAAAAATATAAAAAATATTCCTATAGAAATATTACATTTTTAATAGGAATTTTAAAAATATTCCTATTAAAAATATGAATGTAAAAGATAGATTTGTGAGGGGTGTACTCATATATGCTGAGCATTGTATACATCCTATCGTTCTAAAACTACAAATCATAATCTGAAGACATGTTTTTGGTATAAGGTGTATGCTTATATTATGACTATTTTTTATTGTACAAGTGGGCAAAATTCTTGACTGATCTTGTAAACAAATGGTAAAATATCAGCTGATATGCTGGTCTCTCACTAGTTAAAAAAAAACTCCCTTTTTCTTATTTTTCCTCCCCCAGTTTTGAGAGTACAGTGCAGATCAGTAAGCTGCAGGATCTGGTGAATCGCAGTAAAATGGCTCGTTGTAGAGGAAGATTTGTCTGCCCTGTCATCCTCTACAATGGAAAG[G/A]TAACTATCTTGTCGCCCCAATTCAATTTTCACTGCAGTATTTGCAACATAGTATCGCTTTAGACCGCCAGATGCTTTCTATTGCTTTGCATTGCTGATGTAATAAACTGCTGATATTTTTGTCGGACATGCCCATAAAATATATTGATAGATAATTCACAGAATCAATAACAGATTGAATCTTTTCTTGTGAAATCTGGCTGTCGGGATTCTTTAGTACTGAAGTGTTGAGTTCTGGACTCAGCCTTTGAATTTAAAGGTTGGTATAATTTACTGGGAGATTCAAAGCAGTTTCCAGTCTCCTCTGTAGTTAGCTTTTCCAGGGGCACTTTTTTCAGATTTGTGGTTTTGTTTTGGCAGCCCTAAACTCTTATTATTACTCTTGTGTTGTAGCATGTGTGTCGATCCTCTACACTAGCCGGTTGGGGTGAACTTTATGGACGCACTGGATACAATTACATTTTTTCAGGTACACTTTCAGCTCTGTGTTGTTTTCCTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26739
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083085 Nonsense 356 630 13 19
Genomic Location (Zv9):
Chromosome 6 (position 23393922)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19649368
GRCz11 6 21709590
KASP Assay ID:
2259-7514.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAAGAGTTTTATTAGTAATTTTATACTTTACTTTTTCTAGTCACATGT[T/A]GCCTGACCGGCTCTCTAAGGGAGAGGAGGTAAGACTTTTGATATTTAATT
Long Flanking Sequence:
CATAATAATATTGATAATATTATGATTATTATATGCCTGTTATTTTCTTTAAAAACATAAAACCATTAAAAAAATAAATCACTCAATGTAACTTTAATAAAGTACTGAATTTTTAATGCATGAATTTACTTGTTCTAATATTTTTAAATGCACACAACTAACACGGGAAGTTTGTGATGTGCAGTGTTGGGGAAAAAAGTCACTTTTAAGTCAAATGAAGTCGATTTTTTTTTTAAACAAACCAAAAAGCTAACTAAATGTATTTCTTAGTTACGTGTTTAGTAAAATAGTAAAATTCTTAGAGGAACATGGACTTTAAGTTGTAATATGTAACTTTTTTACTCAACACTGGTTAATTCTACCACATTAGAATTATATAGAAGCTCTATGGTGTTAATTTGTAGGAATCTCAGGAAGCTTCCTGGTATAATCAGTAGATATGCAGCAAAATATAAGAGTTTTATTAGTAATTTTATACTTTACTTTTTCTAGTCACATGT[T/A]GCCTGACCGGCTCTCTAAGGGAGAGGAGGTAAGACTTTTGATATTTAATTCCCAACAAATATTGTCTGTTATTGATTAGGATTGTAATTATGGTTTAGTTTGCACCATCTAGAAATATACGAACAAGAACAGAACATGTTATGTCATAAGTAATCTTTTTTTTCTATGACAACAATTTGAGTCTTGATATTGTCTTTCCTAGATTTTCTTTTTCTGCTTCAATTTTCTGAAGCATATTGTTTGTGAGTCATTTTCAGTCGTGAAAAAACAAAGGTAAGTTATCAGACTTAATTTCTTTAATGCAAACATGGAAATATTTTTAATTTGTAAAAATACTGAAATGACTGTGAGATATTGGCATGTTTTGTTTCTGTGCAGACTTATGTTGTTCATTTCAAAAGTGGTGGAATAACTATTTATTTCACCACAGGTCTGTCCCAGCCTAGATATAGTGAATAGTGCATTCAAAATGAATATCAGATCATTTAGTTGGCATAGTT
Associated Phenotype:
Not determined