Busch Lab

ZMP

rabep1

Ensembl ID:
ENSDARG00000059600
ZFIN ID:
ZDB-GENE-060526-165
Description:
rab GTPase-binding effector protein 1 [Source:RefSeq peptide;Acc:NP_001116759]
Human Orthologue:
RABEP1
Human Description:
rabaptin, RAB GTPase binding effector protein 1 [Source:HGNC Symbol;Acc:17677]
Mouse Orthologue:
Rabep1
Mouse Description:
rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI Symbol;Acc:MGI:1860236]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15851 Nonsense Available for shipment Available now
sa14919 Nonsense Available for shipment Available now
sa20551 Nonsense Available for shipment Available now
sa11256 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26593
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 329 850 8 18
Genomic Location (Zv9):
Chromosome 5 (position 60753150)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58385277
GRCz11 5 59054986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACTTTTATTTATTTGTCCAGGAAGAGGATGAGCAGGAGCGATTGAGT[C/T]AAGCTAAAGAGGCCAGTGAGGATGATGGGACGGAGCATGCGGAAGCAGTG
Long Flanking Sequence:
TTTAGCCAGGACACCGGGGTTACACCCCTGCTCTTTCACGAGAAGTGCCATGGGATTTTTAATGACCACAGAGAGTCAGGACCTCGGTGTAATGTCTCATCCGAAAGACGGCGCCCACTGACAGTTTAGTGTCCCCTTCACTTTTACTAGGGCATTAGGACTCACACAGACCACAGGTTGAGCGCCCCCTGCTGGCCTCACTAACACCACTTCAAAAAAACGGGATCATGAAAGAAACATTCAGAAAGCAACTCATGTAAACACCTTAATCACATTATTCTCTTATTGAGATTAATTTGATTACTGATGTCCTGTAGTCATTAAAGTTGAGTATTGATGGCAGGAGTTTTATGTTTGGGTGAATCATCTAAATGAGAGGTAATAAGAATTTGTCTCAATGCATTACTGCACTGCACCTGCATAGTTTGCAGGGTTATTATGGCATTTATTCCTACTTTTATTTATTTGTCCAGGAAGAGGATGAGCAGGAGCGATTGAGT[C/T]AAGCTAAAGAGGCCAGTGAGGATGATGGGACGGAGCATGCGGAAGCAGTGGAGGATTCGCTGCTTGGACTCTCCATAGAAGAGGTATTAGTGCAAAACTTGTATGAGTGCAATACAGGGATGATATCAAAAAACAAACACATATTTCAATTAATGTAATTTAGTAAGTTTTAGCTAATCAGCGGCTATTCGTTTTTTGTTAATCGATAATGTATAGCTCAACCAGTAATTTTTGTGTTGATAACTTTGTAAATATTGTCATACTAACTGTTGTCTGAATTATTTAAGTTTGATTTTATTCCATTACAGTGTACCTTTCTATCAATCTATCTGACAATATCAAGATCTCGGTTCTTGTCATATTTTATTACCATTTTCTAAACTAAAGTAAATACAGTGATAATTAGGGATGTATTGATTCACATTTGGAATACTAATTTCACGATATATTTTTTAATCAAAATGAGTCGAGACCTCAGAAATGAGCAAGCGCTCTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15851
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 540 850 10 18
Genomic Location (Zv9):
Chromosome 5 (position 60758821)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58390948
GRCz11 5 59060657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGCTCTAATTAYGAGAAACAACTGCAGGTYATCCAGGGACAAGAGGCC[G/T]AGACACGAGAKCAGGTTGGTGCTTCTAYGGCTTCAAAAWCAGGTCTYTAA
Long Flanking Sequence:
GCCGCATTACACTAGTGGCATCTAGTGGCTGTTTCCCAAATCGCACTAGAGTGTCGCCTCTTGGTGATTCTATGCTCTTTGGTGGTGCCGCTCGCTGCAAAAGTTGGGACTTTCTCAACTTTTCAAGCGCAGATGGAAGTGTCAGCCAATCAGATCGCTGTATGCAAATACACCAGCTCAGACAGTAGCCGATTGCTGACTGCTTTCATTAGCTGACGCTTCTATGCTCGCTGTCAAGCGTTGATGCTGAAGCCCCGTGTGAATGGGTTGTTAAAATGCTATTGTTTTGAATTTTTGTTCAAATACACATGCACAGTGAAGCATACGCTTGTTTGAAATATTCAGCGCAGATGAGATATCTGAAGTCTTAATTCAACATGTGTGTTTGTGTTGGTGTGGTTTGACCTCAGCTGAAGAACGCTGGAAGGAAGTTGGGCCGGCGATGTGACATGTGCTCTAATTACGAGAAACAACTGCAGGTCATCCAGGGACAAGAGGCC[G/T]AGACACGAGATCAGGTTGGTGCTTCTATGGCTTCAAAATCAGGTCTTTAAGTAAATCACACAAAAGTGTAGTGAAACTATTGAAAAGGACAGGCTCTGGTCATGTTTCTACAGTGATCTTTCCTTTTTTCCTTTCTTTGCCGTAGGTTAAAAAGCTACAGGCCATCCTGCGGCAGGCGAATGATCAGCTGGAGCGGACGATGAATGAGAAACAGGAGTTGGAGGATTCGGTCAAACAGGCCAATGAGGACACTACTGCCAAGGTGAAACTCATCTCTCTTTAGTGAAGCACAAATGCATTGACAAAACTGGATGTTATCACGTCCTACTCAGTGCAGAAAGTTCAGTAATGCTTTGAGAAAGATACAATAATGCTGTGTCTTCATAATATATTTCTTGCAGGATCCAAACGTTAAATTAACATACTAACACATCACGACTTAATAATGCTTTTTTTTTTTTTGCTTGTTTAAATTTGGCTTTTTGCATGATGCATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14919
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 615 850 12 18
Genomic Location (Zv9):
Chromosome 5 (position 60761294)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58393421
GRCz11 5 59063130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGCGCTCTMCAACAGGCCTTYAGYCAGGCCAAGAGGAAYACCCAGGAA[C/T]AGATGGTACMAGCAAAAACACTYACTCATTTTGCTTCATTAATTTCAACC
Long Flanking Sequence:
GGGTTGTACTAAAATAGGTAAAATAAAATCATATTGACATTAGAAATGTAAGATAATTAATAAGCTAAATTACTTTTTTTTTCTATTCTTTTTTTGCAATGTTAATTAACTATTCTATTATTTATAATTAATTTAAAATAACTATCATCTCAATAGCACTACTTAAGCATAAGAGACTTCTTTGTACCTTACAGTATCGGCATTGTACTGTATAAGGCACTATGGCTTTGCAGCTTACAGTTTGGAAACATCAAATATTTGTTTTCTAAAAATAGTGACTACCTAAGCAGCTCACCGGTAGCTAGAACAAAGCCATTGTTTAAATTTGAAGAATGCACGGACTGCTCTTAATGTTGCCGTTCTTCTAAGTGAAACAATGCTTTAATTTTCATTAATCTGGCACACAGATCTCGGAGCTGAAGCAGAAAGTTCAGGAGTCGGAGTCTCTCTTCAGCGCTCTCCAACAGGCCTTCAGCCAGGCCAAGAGGAACACCCAGGAA[C/T]AGATGGTACAAGCAAAAACACTTACTCATTTTGCTTCATTAATTTCAACCAGAGCATGTGGTTTTTTTTCATGCCACAAAACTGCTCTATTTACTGAAGCCTTCCTGAATGATTAACCCTCAAATGTATTTGTATATTAACGGGAAAGAAGATTTATTTCAGCACATTTCTAAACATAATAGTTTTAACTGCATAGTAAAGTTTCAGGACAAACTTTATGGTGGCTATGGTGGAAAGCCTTATATTCTTAAGGCTGTGTGACAGTCTGATAAAGAGTTATGAGCTCTCAAAGTTTGACCCAATGTTAAGTCAATGGCACTTTTCGGAATTTTCTGGGTCATTTTTTTTGGAAAACTGAAAGTCGGATCAGTTGGAAAAGATATAGCAACCAGAGTCAGACCAGTTTGAAGGTCTGAGGAAAGTTAGAAGGATATAGCTTGGAAGGCTTAGGAGGAGATAGACTTTAAAATTAAAAGAGAAAAATTAAAAGCTGCTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20551
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Nonsense 738 850 15 18
Genomic Location (Zv9):
Chromosome 5 (position 60770063)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58402190
GRCz11 5 59071899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTCCATCCTGTAGCATCTTTTTCCAGCCTAAAGACGGAACTGGAA[C/T]GAGTGAAGAGTGAGAAGGAACAGGTAGGAAAGAACACAGATATGCAAGTC
Long Flanking Sequence:
TGATATGATGTACTTGTAGAAAAAAATGATGTCCATATATGTGGACTCGTGGTCTGAACTTCCATAAAACACAATAAATTCACCTTTGTGTAACCAAATGAAACGCTCTTTATTTCTGCCTTGAATACAGCAGTTTTTTCCTGACTGTTTTAATACATTAATAACACATACACACATTTTTTGAACATGTTTTGACTGTCAGTAAAAAAAAATTATTTGCCCATTTTTGGACGGTTAAAATAGTGTTTGGGACATTTCATATGCTGCAAAACAGTTTCAGGATGACACTTTATGTCTGTAACAAAATATAAGACATAAGAGTTAAAATGTGCTGTCCACGTATGTGGCCACTAAGCCCTAGGATAAAGATAAAGCTAAATATTGTTGTTATCAAAAGTAAAAAAAAAAAACTGCCAAACACTACTACAGCATGTGACTTTTTGTTTTTGTCTTTCTTCCATCCTGTAGCATCTTTTTCCAGCCTAAAGACGGAACTGGAA[C/T]GAGTGAAGAGTGAGAAGGAACAGGTAGGAAAGAACACAGATATGCAAGTCATATGTATACAGTTAAAACCAGAAGTTTACACACTCTCTAAAAAAAAGGAACATAACCATTTTTTTAATTGTCTGATGGTAAATCATACTAAACGTTTACTATTTTAGGTCCGTTAGGATTACCTAAATGATTTACATTTGCTAAATGCCAGAAAAATGAGAACAGTTTTTTTATTTTTTATTTTATTTTTTTATTGATTTCCAGACAGTCAAAAGTTTACATACATTTTCTTGGTATTTTTTAAGCTTTGCTTTTAAACTGTATAACATTGGTCAAATGTTTTGGGTATCCCTCCACAAGCTTCTCACAATAGTTTGCAGGAATTTTGGCCCATTCCTCCTGACAGAATTGGTGTAATAGAGTCAGATTTGTTGGCTGTCTTGCTCACACAAGCTTTTTCAACTTTTTCAATAGGATTGAGCTCGGGGCTTTGTGATGGCCACTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110182 Essential Splice Site 817 850 17 18
Genomic Location (Zv9):
Chromosome 5 (position 60775644)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58407771
GRCz11 5 59077480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGCGAGCAGGTCCAGAGAGATTTYGTCAAACTGTCCCAGACCCTTCAG[G/A]TAAATGYATTTMACTAGAAATTAAACCACAGTTTCATTTCTACACGGTTT
Long Flanking Sequence:
GGAATTGGCTGAGGTGGAGTGACAACAAGCAGCAAGACCTAGCCATGCCCTTACTTATACAGACTTATTATGAAATGGATGAGTTATAAAAAAATTCACACAGTTGTCATGAAAAGTAATATTAGCATTTAACACTCAAAACGTTTTTAGTACCAGGTTTTAAACATCTTTTTTTTCTGCTGTAAAGTTGGCCTTGTAAACATTGGGGTCAATAGAAATGTGCTCTATTTTGGAGTTAGTCCTAGCGGAATTTCGATGAATTGCAGTTTCTTTTACTTCCACATTGGTTTTATGAGGGAGAGTGGGGTGTTGCCACTTGGTTTAAACATGTGAAGATGCAAACATCAAGTCACTGCGAATTTAAAAATGTGTGTTTGATGCAGAGTGCTTTGGAGACTCAGGTGTTTGAAGAGAAAGACAAATCACAGAGACTTCAGGCAGAGCTGGACGTCAGCGAGCAGGTCCAGAGAGATTTCGTCAAACTGTCCCAGACCCTTCAG[G/A]TAAATGCATTTCACTAGAAATTAAACCACAGTTTCATTTCTACACGGTTTGTCAGACAGTCCTGAGAGAGGATAGTATATCTGGCGTTACTTCTTTAGTTATTCTGCCAAATGGCTTCAAGCAAACTCGCATATAGACATTTGAAAACGTTTATTAATTATTTGTTAATTTAGTTATTAATAAGTGAATGATTTAGTTGTTACATTTCATTTTGAAAGACCAATTAAACCTTTTCTAATATGCTTGTTTGAAGTTAACGTGGTTCATCTACTGTATGTACACACTGTTTAAAAGTCTGATTTTAGATAGATGTTTGTTTCTTTGTTTTTATTTTTTAAGGTTACTTTTAATTAGATAATGCACCCTTGATTCTTAATTTTGAGGAACATAATTTGAAGTTAAAAAAGGAAATAAATTGCAATATATTACTAAATATCACAAAATAATTAAAATCGCAATGATATTGTATCGTGAAATGAGTATCATGATCATATTGTACC
Associated Phenotype:
Not determined