Busch Lab

ZMP

PAPPA (1 of 2)

Ensembl ID:
ENSDARG00000059544
Description:
pregnancy-associated plasma protein A, pappalysin 1 [Source:HGNC Symbol;Acc:8602]
Human Orthologue:
PAPPA
Human Description:
pregnancy-associated plasma protein A, pappalysin 1 [Source:HGNC Symbol;Acc:8602]
Mouse Orthologue:
Pappa
Mouse Description:
pregnancy-associated plasma protein A Gene [Source:MGI Symbol;Acc:MGI:97479]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa17987 Nonsense Available for shipment Available now
sa33777 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25323 Nonsense Mutation detected in F1 DNA Not yet available
sa17783 Nonsense Available for shipment Available now
sa33778 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17987
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Nonsense 135 1591 2 24
Genomic Location (Zv9):
Chromosome 5 (position 73416542)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69617703
GRCz11 5 70356127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTYAACTGTATTTATTATTGTACTTTCCCACTTAYAGGTCTCTTCGAC[A/T]AATGCTTCTACGCCTCTAGTGATCGTGGATGGCTCTTGGGAATTAAATCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33777
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Essential Splice Site 490 1591 4 24
Genomic Location (Zv9):
Chromosome 5 (position 73434148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69600097
GRCz11 5 70373733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATCTAGACATACGCGTATGTTCACTCTCCCTCTCCATCTGTGACTCC[A/T]GGGCCTATCTAGATGTGAAGGAGCTGAAAGAGATCCTCAAGCTGGACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25323
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Nonsense 801 1591 8 24
Genomic Location (Zv9):
Chromosome 5 (position 73470851)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69638001
GRCz11 5 70410436
KASP Assay ID:
554-7515.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATGCGGTGGTCCCCGATTCCCTGACAGTTTGGGTCACTTTCTCCTCC[C/T]AAGACGAAACGGTTCTTCCAGCAATCCACAATATCATCCTGTTGACCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17783
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Nonsense 1078 1591 14 24
Genomic Location (Zv9):
Chromosome 5 (position 73520404)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69687554
GRCz11 5 70459989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCTGGTTTCCATGYCGAGAGGCTCACAGTGTTCCCTGGTATCCCCCGTA[T/A]TGGTTGAAGGTGAGCTGTCTTTAWCATTGTAGTTTWATTTTATTTATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33778
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Essential Splice Site 1082 1591 15 24
Genomic Location (Zv9):
Chromosome 5 (position 73520629)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69687779
GRCz11 5 70460214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTATATACTTCATCAGCATAAGCGTAAGAGTAAATCTTGTCTCCGAC[A/T]GGCTTATTTCTCTCATCCTATGGTTGCTGCTGCTGTTATCATCCATTTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7018
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082858 Essential Splice Site 1443 1591 21 24
Genomic Location (Zv9):
Chromosome 5 (position 73544975)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69712125
GRCz11 5 70484560
KASP Assay ID:
554-4667.1 (used for ordering genotyping assays)
KASP Sequence:
CACTGTATATACAGCATATKTGATGTGTRTGCNNNNGTGTGTGTGNTTTGTGTGT[C/T]TCTCTCAGGGTGCGGGCTCTAATGTGATCCGCTGCAGAAAAGACGGCAAC
Associated Phenotype:
Not determined