Busch Lab

ZMP

tead1

Ensembl ID:
ENSDARG00000059483
Human Orthologue:
TEAD1
Human Description:
TEA domain family member 1 (SV40 transcriptional enhancer factor) [Source:HGNC Symbol;Acc:11714]
Mouse Orthologue:
Tead1
Mouse Description:
TEA domain family member 1 Gene [Source:MGI Symbol;Acc:MGI:101876]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41070 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41070
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082740 Essential Splice Site 114 384 6 12
Genomic Location (Zv9):
Chromosome 7 (position 68151367)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 65675995
GRCz11 7 65899643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGTGGATAGCCGCTGTTTTCTTTGTCTATTTATTTGTCCAATTCTCT[A/G]GTTTTGGCAGGGCATGATACCGACAGGCCAGCCTGGATCCTCCCAAGAGT
Associated Phenotype:
Not determined