Busch Lab

ZMP

si:dkey-70b23.1

Ensembl ID:
ENSDARG00000059472
ZFIN ID:
ZDB-GENE-100922-256
Human Orthologue:
ARHGAP31
Human Description:
Rho GTPase activating protein 31 [Source:HGNC Symbol;Acc:29216]
Mouse Orthologue:
Arhgap31
Mouse Description:
Rho GTPase activating protein 31 Gene [Source:MGI Symbol;Acc:MGI:1333857]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7014 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20586 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3531
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082696 None None 1304 None 21
ENSDART00000134386 Nonsense 411 554 10 10
Genomic Location (Zv9):
Chromosome 5 (position 70678481)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67003625
GRCz11 5 67681994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGGACTTGGAATCTCAGACGGCTTCAGGAGGATCCCTGAACGAGAAA[C/T]GAGAAGGAGCKTCGAACGCATCTTCGTYGTCTTCATCACCATCATCAKCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7014
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082696 Essential Splice Site 626 1304 16 21
ENSDART00000134386 None None 554 None 10
Genomic Location (Zv9):
Chromosome 5 (position 70672938)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66998082
GRCz11 5 67676451
KASP Assay ID:
554-4903.1 (used for ordering genotyping assays)
KASP Sequence:
CGTTAAGTAAGTCATTTATGGATGAACCATCTCTTTAAGCYACGTTCTTC[C/A]CTCAAAACATWATTTTTCCTGATTGTTCAAACAACTTATTTAAAATTAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7904
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082696 Essential Splice Site 631 1304 17 21
ENSDART00000134386 None None 554 None 10
Genomic Location (Zv9):
Chromosome 5 (position 70672488)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66997632
GRCz11 5 67676001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCACTTCATAAGCRTAGTGCRAGTTTACTTTACATTACAACCAACAGC[T/G]GAGACAATTTCRGAAACGCACWTKTAAAATTCCCTTTCGTTGWTTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20586
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082696 Nonsense 1118 1304 21 21
ENSDART00000134386 None None 554 None 10
Genomic Location (Zv9):
Chromosome 5 (position 70668459)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66993603
GRCz11 5 67671972
KASP Assay ID:
2259-6855.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACGCTGAGAAGAGCACTGATCAGGTCAACAAAAGCACACCTGAGAAG[A/T]AACCCACCAAAAGCAAGTTGGGAAAAGCAAGTTCTTTATTTCCCCTTCAG
Associated Phenotype:
Not determined