Busch Lab

ZMP

mepce

Ensembl ID:
ENSDARG00000059461
ZFIN ID:
ZDB-GENE-030131-3936
Description:
7SK snRNA methylphosphate capping enzyme [Source:RefSeq peptide;Acc:NP_001122001]
Human Orthologue:
MEPCE
Human Description:
methylphosphate capping enzyme [Source:HGNC Symbol;Acc:20247]
Mouse Orthologue:
Mepce
Mouse Description:
methylphosphate capping enzyme Gene [Source:MGI Symbol;Acc:MGI:106477]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31491 Nonsense Available for shipment Available now
sa33774 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Nonsense 280 528 2 6
ENSDART00000141699 Nonsense 405 701 2 5
Genomic Location (Zv9):
Chromosome 5 (position 71683213)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68007831
GRCz11 5 68778498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCGCATTCGTGTTATGAATCCGGATTGGTTCAGAGGGAAGGATGTGT[T/A]GGATCTGGGATGCAACACTGGCCACCTGACTCTGTTTATCGCAAAAAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5340
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Nonsense 317 528 2 6
ENSDART00000141699 Nonsense 442 701 2 5
Genomic Location (Zv9):
Chromosome 5 (position 71683103)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68007721
GRCz11 5 68778388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAGTATTKTGGGCCTGGATATTGACGGATCGCTGATACATGCTGCTCGA[C/T]AGAATATAAGACACTACCTCTCTGAGGTCCAAGTGCAGCACTCCCGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33774
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Essential Splice Site 470 528 4 6
ENSDART00000141699 Essential Splice Site 643 701 3 5
Genomic Location (Zv9):
Chromosome 5 (position 71677832)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68002450
GRCz11 5 68773117
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGCCCCAGCCCTGGAGCTCCTACAACAAGAGGAAGAAGCTCACCG[T/C]AAGGCCACAACATTTTCATCACATCACTGATCATTTAAGATGCACAACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3568
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082674 Essential Splice Site 511 528 5 6
ENSDART00000141699 Essential Splice Site 684 701 4 5
Genomic Location (Zv9):
Chromosome 5 (position 71673637)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67998255
GRCz11 5 68768922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGCTTCTCCAGTTATGAGCTCATTGGGACGTCRCAAAACTACTCCAAAG[G/A]TCAGAGCTTTGNATATATATATATCAGAGATGCCCAAAYTAGGGCCTGCA
Associated Phenotype:
Not determined