Busch Lab

ZMP

SBF2

Ensembl ID:
ENSDARG00000059460
Description:
SET binding factor 2 [Source:HGNC Symbol;Acc:2135]
Human Orthologue:
SBF2
Human Description:
SET binding factor 2 [Source:HGNC Symbol;Acc:2135]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6088 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21129 Essential Splice Site Available for shipment Available now
sa45300 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2358 Essential Splice Site F2 line generated Not yet available
sa34231 Nonsense Mutation detected in F1 DNA Not yet available
sa38653 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6088
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 255 1898 7 42
Genomic Location (Zv9):
Chromosome 7 (position 68898740)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66776761
GRCz11 7 67000409
KASP Assay ID:
554-3858.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAGGCCTGCCGTGCCTTAGAGACCCTCATGTTTCCTCTTAAATACAGG[T/A]GAGTCAAGACTAGGGCTACTTTTGTCTTTTTCAAATATTCCCCNAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21129
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 469 1898 13 42
Genomic Location (Zv9):
Chromosome 7 (position 68917621)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66795642
GRCz11 7 67019290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAACTCCAGAAGCGCTTGAGGGAGCTGTCCGAGCAGCTTTACAAAAAC[G/A]TAAGCACATGACGCTGATTCTCATGTCCCTTCCGTCAGGTGTTTGAGAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8297
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 538 1898 14 42
Genomic Location (Zv9):
Chromosome 7 (position 68920726)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66798747
GRCz11 7 67022395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTACCCGTCCTGAGAAGAAATGTGTGGTGCCCGCCGGACCCCCTGTGGG[T/C]RAGTAAATTATATAACAAGGCCCTAAAYACKGTGTATTTGTGTATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45300
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 574 1898 15 42
Genomic Location (Zv9):
Chromosome 7 (position 68922102)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66800123
GRCz11 7 67023771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGTGCATCGGCTTCATCTTCGACAACAAGACTCTGGAGACCGAAAAGG[T/G]GATGCAATAATTCCTGTGATGAAGATTAAACTTGCACATCTGGGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2358
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 648 1898 18 42
Genomic Location (Zv9):
Chromosome 7 (position 68977578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66855599
GRCz11 7 67079247
KASP Assay ID:
554-2789.1 (used for ordering genotyping assays)
KASP Sequence:
TATTTTAGCAGACTGCCTTGTGCTGCCCGCTGATCCATCTTTTTGCTTGC[A/T]GAAACTGGCAGSTGGAGTGGATCAGTTCGCCTACACCTGCATCCAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34231
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Nonsense 757 1898 19 42
Genomic Location (Zv9):
Chromosome 7 (position 68980275)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66858296
GRCz11 7 67081944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGTGAAGAGTGAGGAGAGCACAGTGTTCAGTCAGGCCATCCACTA[C/A]GCCAGCCTGATGGTTTACCTGCTCGTCCCATTGGACACCAGCAAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38653
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082664 Essential Splice Site 1294 1898 30 42
Genomic Location (Zv9):
Chromosome 7 (position 69034456)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66912477
GRCz11 7 67136125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCCTGTTTCTCCGTGCCATCAACAACTCCTGCACCTCTAATCTACCA[G/A]TACTCGGGTACAGGGATAAACTTTTCACTCACTCAAACCAAAAAGCTTCA
Associated Phenotype:
Not determined