Busch Lab

ZMP

si:dkey-123f20.1

Ensembl ID:
ENSDARG00000059425
ZFIN ID:
ZDB-GENE-060526-196
Description:
gamma-2-syntrophin [Source:RefSeq peptide;Acc:NP_001119899]
Human Orthologue:
SNTG2
Human Description:
syntrophin, gamma 2 [Source:HGNC Symbol;Acc:13741]
Mouse Orthologue:
Sntg2
Mouse Description:
syntrophin, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:1919541]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6456 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16222 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6456
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082586 Essential Splice Site 136 543 6 17
ENSDART00000141083 Essential Splice Site 136 540 6 17
Genomic Location (Zv9):
Chromosome 17 (position 3203844)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 3415866
GRCz11 17 3456885
KASP Assay ID:
554-5295.1 (used for ordering genotyping assays)
KASP Sequence:
KCTGCAGGTCAACGGCATTAACGTGGAGAAATGCACACATGAGGAAGTGG[T/G]GAGTACTGGACGGCTCTTTCATCTGTGGTCTTGAAATGACATTGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16222
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082586 Essential Splice Site 239 543 9 17
ENSDART00000141083 Essential Splice Site 239 540 9 17
Genomic Location (Zv9):
Chromosome 17 (position 3237418)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 3449440
GRCz11 17 3490459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTCATGGCTCGAAKCTCTCGACGCAAAGCTGGAACCGACAAATTAAGG[T/C]ACGGTARTCCGCCGTGATGCTGTARGGTTTTGCCACGCGCCGCTCCCAAT
Associated Phenotype:
Not determined