Busch Lab

ZMP

rictora

Ensembl ID:
ENSDARG00000059414
ZFIN ID:
ZDB-GENE-060526-49
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE46]
Human Orthologue:
RICTOR
Human Description:
RPTOR independent companion of MTOR, complex 2 [Source:HGNC Symbol;Acc:28611]
Mouse Orthologue:
Rictor
Mouse Description:
RPTOR independent companion of MTOR, complex 2 Gene [Source:MGI Symbol;Acc:MGI:1926007]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa26397 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15967 Nonsense Available for shipment Available now
sa44598 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Essential Splice Site 412 795 13 23
ENSDART00000134379 Essential Splice Site 492 1614 15 35
Genomic Location (Zv9):
Chromosome 5 (position 7722057)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8077004
GRCz11 5 8581642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGCAAAACCTGGACTGGAACTGGATTTTGATCATCACTATACTGAAG[G/A]TAAAAACCCACATTTAGTTATAAACAAATGTAATTTTATGTTTAGAAAAA
Long Flanking Sequence:
CTTCTAAAACAAGCAAACAAAAATTACATAAATAACTGCTTACACACAAAACATTAAATAAAATACACATATACTCACAATTGAGCGATAACTTCGAAAGTGCTCAACCATTGGACTAAATGTGAAGGCCTTTAGCGAAAGTGATCCATGTGGTGGCCACTTTACCAAACACTCCTTCTTTCTCTATGGTAAGTGACTTTTTATACAGGTGCAAATCAACCTAGTGCCCCTGGTGGTCGGAAGCAGTATTACATGTCCACATACCAAACAAAACACAATGCAAGAAAATAAATAAATAAATCAGAAAGTAATAGTAGTAACATTTAACATGTTACAGTTTATATTGATATAATAAGATACTTAAACAGGAGAGTTTGTTGTTTGTGTGTGTGGTGTAGGACACTGAAGAGGCGCTGATGATGAACCTGAGGGACAGTCAGATCCTCAATCACAAGCAAAACCTGGACTGGAACTGGATTTTGATCATCACTATACTGAAG[G/A]TAAAAACCCACATTTAGTTATAAACAAATGTAATTTTATGTTTAGAAAAAATGCATGTTTTCTTTTACCAGTTCACTCAGTAAGCAGTACTCCATGCATTCAGAAAATTCCCTTCTTGTGTACAGTATACATATTATACTGCTTATTTCAGAAAGTATGTGTAGAATGTCAATACAGTCGCGTTAAAGTGGAACTATTGTGCAAAAATCACTTTTTTAAAGGGATTAAACGTAGTTGTGTGGCAAATCTCTGTGAATATAAAAAGCTTCTATTAGTAAAAATGTATTAATTTAATTTGTTTATAATCACACTTGATAAAAATACTATGCAGAAACACTTTGACTGACATTCTCCATTTGTACATGTCATCATAGGGAAAAAGCCCCATCCATTAGTGACCATTTTTCCCTCATTAGCATAAGACGTTAGTCTTGTTTTTGAATCTGCCACTATGCTGACACAGACATCTGTAGCTCCGCCCTCTTTTAAATAGAGCTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26398
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Essential Splice Site 412 795 13 23
ENSDART00000134379 Essential Splice Site 492 1614 15 35
Genomic Location (Zv9):
Chromosome 5 (position 7722058)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8077003
GRCz11 5 8581641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCAAAACCTGGACTGGAACTGGATTTTGATCATCACTATACTGAAGG[T/C]AAAAACCCACATTTAGTTATAAACAAATGTAATTTTATGTTTAGAAAAAA
Long Flanking Sequence:
TTCTAAAACAAGCAAACAAAAATTACATAAATAACTGCTTACACACAAAACATTAAATAAAATACACATATACTCACAATTGAGCGATAACTTCGAAAGTGCTCAACCATTGGACTAAATGTGAAGGCCTTTAGCGAAAGTGATCCATGTGGTGGCCACTTTACCAAACACTCCTTCTTTCTCTATGGTAAGTGACTTTTTATACAGGTGCAAATCAACCTAGTGCCCCTGGTGGTCGGAAGCAGTATTACATGTCCACATACCAAACAAAACACAATGCAAGAAAATAAATAAATAAATCAGAAAGTAATAGTAGTAACATTTAACATGTTACAGTTTATATTGATATAATAAGATACTTAAACAGGAGAGTTTGTTGTTTGTGTGTGTGGTGTAGGACACTGAAGAGGCGCTGATGATGAACCTGAGGGACAGTCAGATCCTCAATCACAAGCAAAACCTGGACTGGAACTGGATTTTGATCATCACTATACTGAAGG[T/C]AAAAACCCACATTTAGTTATAAACAAATGTAATTTTATGTTTAGAAAAAATGCATGTTTTCTTTTACCAGTTCACTCAGTAAGCAGTACTCCATGCATTCAGAAAATTCCCTTCTTGTGTACAGTATACATATTATACTGCTTATTTCAGAAAGTATGTGTAGAATGTCAATACAGTCGCGTTAAAGTGGAACTATTGTGCAAAAATCACTTTTTTAAAGGGATTAAACGTAGTTGTGTGGCAAATCTCTGTGAATATAAAAAGCTTCTATTAGTAAAAATGTATTAATTTAATTTGTTTATAATCACACTTGATAAAAATACTATGCAGAAACACTTTGACTGACATTCTCCATTTGTACATGTCATCATAGGGAAAAAGCCCCATCCATTAGTGACCATTTTTCCCTCATTAGCATAAGACGTTAGTCTTGTTTTTGAATCTGCCACTATGCTGACACAGACATCTGTAGCTCCGCCCTCTTTTAAATAGAGCTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Nonsense 614 795 18 23
ENSDART00000134379 Nonsense 693 1614 20 35
Genomic Location (Zv9):
Chromosome 5 (position 7733726)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8065335
GRCz11 5 8569973
KASP Assay ID:
2259-5398.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCCAATGTTGAGTTCTTCAGTAACTGGGGGATGGAGCTGCTGGTCACG[C/T]AGTTGCACGACCACAAYAAAACCATCTCAATGGAGGCGCTCGAYATTCKG
Long Flanking Sequence:
TGACTCCGCTTGAATTGTTTTGCTAGGAAGAATGGGCAAAGATTTCAGCCTCCAGATATGCAAAGCTGGTAGAAGCATATCCCAAAAACTTGCAGCTGTAATTGCAGCTTCCACAAAGTATTGACTCACAGGGGCTGAATACTTTTGCACACTGCTTTTTTCAGTTTTTTTATTTGTAAAGAAAAAAAAAAAAGAATTTGTGTATAATTTGCTTTATATTTCACAATTGTATGTCATTTTGTGTTGGTCTTTAACATAACATTCCAATAAAATAGATTTATGTTTGTGTTCATAATGTGAGAAAATGTGGAAAAGTTCAAGGGCTATGTGTACTTTTGCAAGCCACTGTAGATTTGATGAATGACTCAACCTAAAATTGATGGTATTTGTTGTTTGTGCTGCTTCAGAACTGCCGCTTGTACGCCACCAAACACCTGCGTGTGCTTCTGCGTGCCAATGTTGAGTTCTTCAGTAACTGGGGGATGGAGCTGCTGGTCACG[C/T]AGTTGCACGACCACAACAAAACCATCTCAATGGAGGCGCTCGACATTCTGGACGAGGCCTGCGAAGACAAGGTGATTAATGAAGATCAGTAGCTTATGCCATTTCTGATGTTACGATCTGTTAAATGCAAATGAAATCAAAACTAACCATATTGATTTTGTTGGCTCACATTGCTAGTTTTTAGGTGAAAAATATATCTGTGCATGTCATTAAGTAAAAACAAATAGTTTGCTCTTATAATCTTTAATTGAAATCTGTAAATGCACTTCCTGTTTGTTTTAAGTTAAATTCTCAGATTATATCTGTCTGAGGTATTGAGCGTTGCTAACATACTTAACCACATCCCTCTACTGTCAGTTTTGACAACAAACAGAAATGGTGAGGAGGAGGAGTCTGTTAGGTTGTAATAACTCTCCCCAAACTCTTTACCTGATCTTTCTGAATGAACTTTACTACATCCAATCAGCTCGCAGTAGAAAAAAACAAGCCACGCCCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44598
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082536 Nonsense 710 795 21 23
ENSDART00000134379 Nonsense 789 1614 23 35
Genomic Location (Zv9):
Chromosome 5 (position 7738725)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8060336
GRCz11 5 8564974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATATGTGGACATGATTGAAGAGCAGCTGAATGAAGCTCTTACAACATA[T/A]CGCAAACCTGTCGACGGAGACAACTACGTCAGGCGCAGCAACCAAAGGTC
Long Flanking Sequence:
ACACTTGCACCGGTTTTGCACGTTGACACTCCAAATCTCTTAAACAAAAGCAAAAACTAATGAAGTGTGCCTCACACAGGTGAGTGGGCTTGACAAACCACCCGTAGGAACACTCTGCCATGTCAAACAAAATCTTCTTCCTTACTCTTGCACTTATTTCTCTAAAAACTAATAGTTTTCTATGTATAAATAGCACTTTTTGTGTCTCTGTCTGTCAAATGCATCTCAAACGCATCACCTAAATGGTTTGTAAGTCACTTTTTCTCTCTCATATATCTGTAGATTTCTTTCCATCCCGAAAGGCTTCTCCTACCTCAACGAAAGAGGCTACGTCAGCAAACAGCTGGAGAAATGGCTCAAGGTGAAATATCAACTTTTAAACTCTGTGTTTTTCTTCCTCTTGACTGCAGTTGTAGTAAACTGTGTGTGTTTTTGCAGGAGTATAATCTGAAATATGTGGACATGATTGAAGAGCAGCTGAATGAAGCTCTTACAACATA[T/A]CGCAAACCTGTCGACGGAGACAACTACGTCAGGCGCAGCAACCAAAGGTCTAATCACAGCTCATATTCATGCACATTTAGTTTGAAATATGTTTGCAAATTGCTATAACTATTGCACAAATAACAGGTTGGTTCCTGGGGCTCATTAATTTTTGTTATTGGTAATAAATATATTATTATTTAATTTATTATTAATTTGGTAGTTAAATTAAAGCTCAAAAAATATCATTAAGCTTTTAAAAATATCTAAAATAAATGAAATGGCTTTGTTGTTTTGAAGTACAATTTACAAACCTTCTTTAAAAAAAGATGTACAATTATTTTCCATTTATTTTGACAAATTGCATAAAGCGCAACTGAAACAAGCTTGTATAATTATGTAAAATAAATCAAATGTATTTGTTTGTCATTTTGAAGTAAAATTTACTAACATCATTAAAACAGATATAAAGCTATTGATTTAATATTTATTAGATGTTTAATATTTAATAAAGATTTCAT
Associated Phenotype:
Not determined