Busch Lab

ZMP

gria4b

Ensembl ID:
ENSDARG00000059368
ZFIN ID:
ZDB-GENE-030131-8013
Description:
glutamate receptor, ionotropic, AMPA 4b [Source:RefSeq peptide;Acc:NP_997917]
Human Orthologue:
GRIA4
Human Description:
glutamate receptor, ionotrophic, AMPA 4 [Source:HGNC Symbol;Acc:4574]
Mouse Orthologue:
Gria4
Mouse Description:
glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa3112 Nonsense F2 line generated Not yet available
sa13954 Essential Splice Site Available for shipment Available now
sa43634 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23921 Essential Splice Site Available for shipment Available now
sa23922 Nonsense Available for shipment Available now
sa8999 Nonsense Mutation detected in F1 DNA Not yet available
sa43635 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa3112
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 158 904 3 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 20948715)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21960208
GRCz11 21 21996844
KASP Assay ID:
554-2544.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCTCAGCCTGCTGGACCACTATGACTGGAATCGCTTTGTCTTTCTCTA[C/A]GACACCGACAGGGGTAAGACAATTAAACACCCACTCATAATAATGCACAG
Long Flanking Sequence:
TGTGTAACATTTTGTACTACGGTGCAGAAATGAGCTGAACTGGTAATCGAATCCATGTAGAAAATATATGCGCTTGTTCAGGTGGTGGATGGGTCTCCCAGGCTGTTTCATTAATGTTTCAAACACCTACGGAAAAGCCCTACACAGGATCACTAACGTAAGCTAGGTCCTAATGCTCTAAAGTGAAGTAAATGTTCAGCGCTCCCTCAGGAATTATGTAATTAATGTTTTAAGCATCTAACTCTCTCTTCCTCTTTGTTGTTGTGCTTTGCAGTCTGTTCCCAGTACTCACGGGGCGTCTTCGCCATTTTCGGCCTGTACGACAAGAGGTCGGTTCACACGCTAACATCATTCTGCGGCGCGCTGCACATCTCCCTCATCACACCCAGTTTCCCCACCGAGGGCGAGAGCCAGTTCGTCTTACAGCTGCGGCCCTCCATACGAGGGGCCCTGCTCAGCCTGCTGGACCACTATGACTGGAATCGCTTTGTCTTTCTCTA[C/A]GACACCGACAGGGGTAAGACAATTAAACACCCACTCATAATAATGCACAGTTCACTTTGCTGGGTAGATCAGAGAAATGCCCGTGAAAATGATTAACAGGTATGCATACTGGCTTTGAATATTAAAGGGATAGATCACCCAAAAATTAACATTTCCTGTTAATGTACTCATCCTCAAATCATCCAACATTTAGATGTATTTCTTTCCTTCTTCAGTAGAGCATTGAAGAAGATTTTTTAGCTGAATATGTGGTCCTTGGTTATTTATATAATGGCAGATAAGGACTTAAGTTTTCACTTTAGTGTGAAAACACTCATTGTCCATATGTATTGGCATTTTTACTGTGTTTTAGAAAAATTTTCCCACTATATATACTAAAACTTATGATATGTGACCATTCATGCTCAGTGGGCATGTGCAATGTTTGCCTGCATCAGTTCTTGCCATCTACCAGTTGTGTAATGGTTATATGAGAGTGACATGACGAATCAGGGAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13954
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Essential Splice Site 163 904 3 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 20948730)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21960223
GRCz11 21 21996859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCACTATGACTGGAATCGCTTTGTCTTTCTCTAMGACACCGACAGGGG[T/A]AAGACAATTAAACACCMACTCATAATAATGCACAGTTCACTTTGCTGGGT
Long Flanking Sequence:
ACTACGGTGCAGAAATGAGCTGAACTGGTAATCGAATCCATGTAGAAAATATATGCGCTTGTTCAGGTGGTGGATGGGTCTCCCAGGCTGTTTCATTAATGTTTCAAACACCTACGGAAAAGCCCTACACAGGATCACTAACGTAAGCTAGGTCCTAATGCTCTAAAGTGAAGTAAATGTTCAGCGCTCCCTCAGGAATTATGTAATTAATGTTTTAAGCATCTAACTCTCTCTTCCTCTTTGTTGTTGTGCTTTGCAGTCTGTTCCCAGTACTCACGGGGCGTCTTCGCCATTTTCGGCCTGTACGACAAGAGGTCGGTTCACACGCTAACATCATTCTGCGGCGCGCTGCACATCTCCCTCATCACACCCAGTTTCCCCACCGAGGGCGAGAGCCAGTTCGTCTTACAGCTGCGGCCCTCCATACGAGGGGCCCTGCTCAGCCTGCTGGACCACTATGACTGGAATCGCTTTGTCTTTCTCTACGACACCGACAGGGG[T/A]AAGACAATTAAACACCCACTCATAATAATGCACAGTTCACTTTGCTGGGTAGATCAGAGAAATGCCCGTGAAAATGATTAACAGGTATGCATACTGGCTTTGAATATTAAAGGGATAGATCACCCAAAAATTAACATTTCCTGTTAATGTACTCATCCTCAAATCATCCAACATTTAGATGTATTTCTTTCCTTCTTCAGTAGAGCATTGAAGAAGATTTTTTAGCTGAATATGTGGTCCTTGGTTATTTATATAATGGCAGATAAGGACTTAAGTTTTCACTTTAGTGTGAAAACACTCATTGTCCATATGTATTGGCATTTTTACTGTGTTTTAGAAAAATTTTCCCACTATATATACTAAAACTTATGATATGTGACCATTCATGCTCAGTGGGCATGTGCAATGTTTGCCTGCATCAGTTCTTGCCATCTACCAGTTGTGTAATGGTTATATGAGAGTGACATGACGAATCAGGGAATGATATTTAATTCTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Essential Splice Site 242 904 5 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 20967103)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21978596
GRCz11 21 22015232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGTCGGCAAGCATGTCAAAGGCTACCATTACATCATGGCAAATTTGG[T/G]GAGCTAAATTGTATTCCTTTATCGCCTTATTTTCCCTGTCAGCTTGTCCT
Long Flanking Sequence:
GAGAATTGCAAATAGATTGGTTGCAAATGTTTTTTAGGGTCTGCACACTGTACCAAATGTAGTGCATCATGCTTAACTAAAAAGAAATATTCACAAGCACAAGGTCCTGAGGGAACAAAGAACAGATTTCCTGAAATGACACATTAGACAGGCATATTTCTTTATTCCCTGCAAACTGATCCCTTGATATTTCTTTTTACAACATTTTATAGCTGTCAAAGCAGTTTTAAGATGTATTCTAGCCGCTGTTTGCTTTAATATTCCTCAATTTACAGAGCAGTATGGGAAAAGGCAGCTTGTTTGAATAGAAATAATTAATAACAGCAGAATTTTGCTTTCCCTACGGCTTACAGCTCTGCTGTAGATTCATATGCTGGGTGAATGCCGACAACTGTATTTGCTTTTAGGATTTACCCTCACTGCAATGTCTGGTTTATCTCTGCAGATTGTGAGTGTCGGCAAGCATGTCAAAGGCTACCATTACATCATGGCAAATTTGG[T/G]GAGCTAAATTGTATTCCTTTATCGCCTTATTTTCCCTGTCAGCTTGTCCTCCTTTCATATGCTGTTTTATCTCTTCCTTTCGACACATTCCTCTCCACTGGTCTCTCTCTCTCTTTCCATCTCTTTAGTTGTCTTGTCCTCTCTGTTTCCTGCCCTCCCTCGTTCTTTTTCTTTCTTAATCCTCGCTTTTCTTTAAGCAAGATACGTCAATTTGAGAGACTAATTCGTATTCCAGTGTGAGCGCTGGTGACAGTGTTTTAATGATGCTGGGAGCTGCAGAGCGTGCTCTCTCTCCCTGCTCTCTGGCTGTGCACAGAATTGGCTCAGAGAGGCAAGCTGGATATGAATGTTTGTGGAATTTCTCTTATCATAGCGCTGCATTGCCGACGACGTTTTAATAATCTCTCTCCCTCTCGCTGTATTTCTTACTCTTTCCCCTTCTTTGCTCTGGCAGGGTTTTAAGGACATCAATCTGGAGCGTTTCATGCATGGGGGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23921
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Essential Splice Site 295 904 6 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 20967718)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21979211
GRCz11 21 22015847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACAAGCTGGACCAGCGCGAGTACCCCGGCTCTGACGCACCTCCCAAGG[T/G]AACGTTGCATGGCTTGGTCCAGCGCACAACCGCTTTGAAGCCTGATATAT
Long Flanking Sequence:
TTCCATCTCTTTAGTTGTCTTGTCCTCTCTGTTTCCTGCCCTCCCTCGTTCTTTTTCTTTCTTAATCCTCGCTTTTCTTTAAGCAAGATACGTCAATTTGAGAGACTAATTCGTATTCCAGTGTGAGCGCTGGTGACAGTGTTTTAATGATGCTGGGAGCTGCAGAGCGTGCTCTCTCTCCCTGCTCTCTGGCTGTGCACAGAATTGGCTCAGAGAGGCAAGCTGGATATGAATGTTTGTGGAATTTCTCTTATCATAGCGCTGCATTGCCGACGACGTTTTAATAATCTCTCTCCCTCTCGCTGTATTTCTTACTCTTTCCCCTTCTTTGCTCTGGCAGGGTTTTAAGGACATCAATCTGGAGCGTTTCATGCATGGGGGAGCCAATGTGACAGGCTTTCAGCTGGTGGACTTCAGCAATCCCATGGTTATTAAACTCATGCAGCGCTGGAACAAGCTGGACCAGCGCGAGTACCCCGGCTCTGACGCACCTCCCAAGG[T/G]AACGTTGCATGGCTTGGTCCAGCGCACAACCGCTTTGAAGCCTGATATATTAGCATAAATGCATAAGCGTCCTACTTGAGTCCCTCCAGCCACATTGAGAAAACTTGCAAATTACAACAAGACTGTTGATCACACCCACTGGCTTTATAAATGTGTTTAAACTATGCAGAAAGTATGGATGGAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAAGAAAGAAAAAAATGAAAGAATTGAAGAATGGATTGATAAGTGGTTGGGTTAGTTAATGGATGGAAACATAGAAAGCAGTAGAGGATGAGGGGATGAAAGGAATGAAAGAGAAAAATAGATGGAAAAGGGTATATATATATATATAATATATATATATACTGTATGTATATATATATATTAGCGCTGTCAAAATTAACGCGTTAACGCATGCGATTAATTTTAAATAATTAACCCGTTAAAAAAAATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23922
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 438 904 10 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 20996511)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22008004
GRCz11 21 22044640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTAGGAAGGGCCGTATGTAATGCTGAAGAAAAACTGGGAAATGTAC[G/T]AGGGGAATGAGCAATATGAGGGATACTGTGTGGATTTGGCATCTGAAATT
Long Flanking Sequence:
GACTTTTATGTAAAAAAACTATATTTATTTTCATTGTTTTCTTATGGCTAGCATTTGATAAGCACACGCAAACCTATAATGACTGTAATTATCTTTATATGCCTTATGTGATATTTCAATACTTGTATGAACCCTTTGTTATGGTTTCATAAAGCCTTTGGGATATTTTAAAAGTGTTTGATAATACTTTATTAGGGAATGTGAGGACATATTGACTTATGTTAAAGAAAAAACTATATTTTCATTGTTTCTTTATGGCTAACATTTGATTAGTACATGAGAACATAAAGACTGTAATTTATGTTCATTAAGATCTAAAAAGCAGCTTTGTTCGTCTATACCTTCACAATAAGTCATATTTGAAATGTATAGCAGGTTTACAACCACTTTGAACATGTTTGTTTTGTTTAGAAGTGTGACATGCTGCCCATTGAAAGTGCTCTGTTTTGTTCATTTAGGAAGGGCCGTATGTAATGCTGAAGAAAAACTGGGAAATGTAC[G/T]AGGGGAATGAGCAATATGAGGGATACTGTGTGGATTTGGCATCTGAAATTGCCAAACACATCGGTTTCAAGTATAAGATCTCCATCGTGCCTGATGGAAAGTACGGAGCTCGAGACCCAGAGACTAAGATCTGGAACGGGATGGTCGGGGAGCTGGTGTACGGGGTAAAGCATTTTCCTTTTTTGCAATTGTCTGACATTAGCATTAGATTTATAAATGACATTTGATTGTTTGATGGACATGCTTAATATTGGCTGTTTTGCCATTCATTTCTTGTTTTAATGCTTTCCTAAAATTTTTCCTAAAATCTCCCGTAATTTAAAATGTTTGAGGTCAGTGTGATTGATTGATTGATTGATTAAGATATTTATACGATAATTCAGCAATAATTATTTGTTTTATTTTAACAAAAGTAAAGCCACCTTTCCAATGCACATGACAAACGACAAGCGTTAGACCGGAAGTCATTCATTTCCAATGCAGAGGAGTCCGGGAGCTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4949
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 462 904 10 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 20996585)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22008078
GRCz11 21 22044714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTGTGTGGATTTGGCATCTGAAATTGCCAAACACATCGGTTTCAAGTA[T/A]AAGATCTCCATCGTGCCTGATGGAAAGTACGGAGCTCGAGACCCAGAGAC
Long Flanking Sequence:
TATAATGACTGTAATTATCTTTATATGCCTTATGTGATATTTCAATACTTGTATGAACCCTTTGTTATGGTTTCATAAAGCCTTTGGGATATTTTAAAAGTGTTTGATAATACTTTATTAGGGAATGTGAGGACATATTGACTTATGTTAAAGAAAAAACTATATTTTCATTGTTTCTTTATGGCTAACATTTGATTAGTACATGAGAACATAAAGACTGTAATTTATGTTCATTAAGATCTAAAAAGCAGCTTTGTTCGTCTATACCTTCACAATAAGTCATATTTGAAATGTATAGCAGGTTTACAACCACTTTGAACATGTTTGTTTTGTTTAGAAGTGTGACATGCTGCCCATTGAAAGTGCTCTGTTTTGTTCATTTAGGAAGGGCCGTATGTAATGCTGAAGAAAAACTGGGAAATGTACGAGGGGAATGAGCAATATGAGGGATACTGTGTGGATTTGGCATCTGAAATTGCCAAACACATCGGTTTCAAGTA[T/A]AAGATCTCCATCGTGCCTGATGGAAAGTACGGAGCTCGAGACCCAGAGACTAAGATCTGGAACGGGATGGTCGGGGAGCTGGTGTACGGGGTAAAGCATTTTCCTTTTTTGCAATTGTCTGACATTAGCATTAGATTTATAAATGACATTTGATTGTTTGATGGACATGCTTAATATTGGCTGTTTTGCCATTCATTTCTTGTTTTAATGCTTTCCTAAAATTTTTCCTAAAATCTCCCGTAATTTAAAATGTTTGAGGTCAGTGTGATTGATTGATTGATTGATTAAGATATTTATACGATAATTCAGCAATAATTATTTGTTTTATTTTAACAAAAGTAAAGCCACCTTTCCAATGCACATGACAAACGACAAGCGTTAGACCGGAAGTCATTCATTTCCAATGCAGAGGAGTCCGGGAGCTGCGTGGAGCTCCGATCATCTCCGTATGCTGAAAATTCTGATCCGATTTGAGCTGCGACTCAAAATAAAAATAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8999
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Nonsense 612 904 11 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 21000251)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22011744
GRCz11 21 22048380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTTCAACAGTCTCTGGTTCTCACTCGGTGCCTTCATGCAGCAGGGGTG[C/A]GACATCTCGCCCAGGTAAGCCGACTCTTCTTGCGAGTAAAAACATTGAAA
Long Flanking Sequence:
GTCTGAACAATGTTTTGTGTTTAATTTTTACGTTGTTGTATTAAGTAGCCTTGTAGTAAGTGGGGTAAAGTAAATTTAGGTGGTTGTTATTGAAGAATAAAGCACACTAACCACTCTACACTGTCTATCTTTTATTTCTAGAAAGCGGAAATCGCTGTGGCCCCATTGACTATAACTTTGGTCCGGGAGGAGGTTATTGACTTCTCGAAACCCTTCATGAGCTTGGGCATCTCCATCATGATCAAGAAGCCTCAAAAGTCCAAGCCGGGTGTCTTCTCCTTCCTGGACCCACTGGCCTACGAGATCTGGATGTGCATCGTGTTCGCCTATATAGGCGTGAGCGTGGTGCTCTTCCTGGTCAGCCGCTTCAGCCCGTATGAGTGGCACACCGAGGAGCCCGAAGAGGGCACTGACGGTCTGCCCAGCGACCAGCCCCCCAATGAGTTCGGGATCTTCAACAGTCTCTGGTTCTCACTCGGTGCCTTCATGCAGCAGGGGTG[C/A]GACATCTCGCCCAGGTAAGCCGACTCTTCTTGCGAGTAAAAACATTGAAATTAAAACCATTTCTCATATATGGTAATGTCTGATAGCTGAAGTAGTCATTGCTGTAGTTTCCATAGTGATTTGATGAAGTGTTTTGCCTGAGTCTGAATTAAAAAGCAGCCAAGTGGGAGAATTTGCATTAAAACTCACTGTTTATTCATTATGTCTGCTTTGAGTCTTTGGGAGAGGGGAACAGTCAGTCACAGTCATCACTAAGTACATTTACATGCACTCTTATAAACATTTAAAACTAAAAAATAAATACACAAAAAAGTTTTAAATCATTTAAATACTTTTTTCTACTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTAGGGGTGTAACGATACACTCAGCTCACGATACGATGTGTATCACGATATAATGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016916 Essential Splice Site 617 904 11 16

The following transcripts of ENSDARG00000059368 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 21000266)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22011759
GRCz11 21 22048395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTCACTCGGTGCCTTCATGCAGCAGGGGTGCGACATCTCGCCCAG[G/A]TAAGCCGACTCTTCTTGCGAGTAAAAACATTGAAATTAAAACCATTTCTC
Long Flanking Sequence:
TGTGTTTAATTTTTACGTTGTTGTATTAAGTAGCCTTGTAGTAAGTGGGGTAAAGTAAATTTAGGTGGTTGTTATTGAAGAATAAAGCACACTAACCACTCTACACTGTCTATCTTTTATTTCTAGAAAGCGGAAATCGCTGTGGCCCCATTGACTATAACTTTGGTCCGGGAGGAGGTTATTGACTTCTCGAAACCCTTCATGAGCTTGGGCATCTCCATCATGATCAAGAAGCCTCAAAAGTCCAAGCCGGGTGTCTTCTCCTTCCTGGACCCACTGGCCTACGAGATCTGGATGTGCATCGTGTTCGCCTATATAGGCGTGAGCGTGGTGCTCTTCCTGGTCAGCCGCTTCAGCCCGTATGAGTGGCACACCGAGGAGCCCGAAGAGGGCACTGACGGTCTGCCCAGCGACCAGCCCCCCAATGAGTTCGGGATCTTCAACAGTCTCTGGTTCTCACTCGGTGCCTTCATGCAGCAGGGGTGCGACATCTCGCCCAG[G/A]TAAGCCGACTCTTCTTGCGAGTAAAAACATTGAAATTAAAACCATTTCTCATATATGGTAATGTCTGATAGCTGAAGTAGTCATTGCTGTAGTTTCCATAGTGATTTGATGAAGTGTTTTGCCTGAGTCTGAATTAAAAAGCAGCCAAGTGGGAGAATTTGCATTAAAACTCACTGTTTATTCATTATGTCTGCTTTGAGTCTTTGGGAGAGGGGAACAGTCAGTCACAGTCATCACTAAGTACATTTACATGCACTCTTATAAACATTTAAAACTAAAAAATAAATACACAAAAAAGTTTTAAATCATTTAAATACTTTTTTCTACTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTAGGGGTGTAACGATACACTCAGCTCACGATACGATGTGTATCACGATATAATGTTCACGATTCGATATGTATC
Associated Phenotype:
Not determined