Busch Lab

ZMP

srsf3b

Ensembl ID:
ENSDARG00000059360
ZFIN ID:
ZDB-GENE-071005-2
Description:
splicing factor, arginine/serine-rich 3b [Source:RefSeq peptide;Acc:NP_958480]
Human Orthologue:
SRSF3
Human Description:
serine/arginine-rich splicing factor 3 [Source:HGNC Symbol;Acc:10785]
Mouse Orthologues:
Gm12355, Srsf3
Mouse Descriptions:
predicted gene 12355 Gene [Source:MGI Symbol;Acc:MGI:3649769]
serine/arginine-rich splicing factor 3 Gene [Source:MGI Symbol;Acc:MGI:98285]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24045 Essential Splice Site Available for shipment Available now
sa13439 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24045
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106636 Essential Splice Site None 164 None 6
ENSDART00000135829 Essential Splice Site None 164 None 7
ENSDART00000137264 Essential Splice Site None 124 None 4
ENSDART00000144309 None None 164 None 6
ENSDART00000145685 Essential Splice Site None 164 None 7

The following transcripts of ENSDARG00000059360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 596703)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 583811
GRCz11 22 621534
KASP Assay ID:
2261-6178.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGAATCAAACACACACACACGGCCAGAAATACGCGATAATTACGG[T/A]GAGTTGTGTTTTTTCTCTTCCATTACGAAATAATGTTTCCAAACGAGCCG
Long Flanking Sequence:
TCGTTTTATGCTTGAGCAACTAAATGAAAGCCAAAGTCTGTTTAACTGATTGTATTTTAATGACATTACAACATCGACGCTGTAAAAGGAACCAAATAAAATGAAAAAAAAAACACAATAACAGATCACCGGAAGTTTATCAATGTGGGAAACACAATAGCTCGGCATATACCCTATTGATAATCTGATAATCTTTTTGAAATTCTTTAATATTGGCATGTATATGCCTGGAATTCCTGTGACTGGGTCTGTTAATCTATCAGTACAGATTTGTAAGTTTTCCTTGTATTTGATTTTAGGGAATGTATGATCATTTATTCGTCGTTTCAGGTTTTCTCTCGCACTAATAAATGTGCATAAACTGAAGCCCCGCCTACTCTGCGTCCATCATGACGTAATACACGTCAGTACGTCCGCGTTTCCGCGCTGCGCCATTTCGGAGCAGACCCGTGCCAGGAATCAAACACACACACACGGCCAGAAATACGCGATAATTACGG[T/A]GAGTTGTGTTTTTTCTCTTCCATTACGAAATAATGTTTCCAAACGAGCCGTTTGTGGTATTTTCTTGATCACTATTAAGTAACGCGTTTGCGTTTTTAACATAATTGTGCTTTTCCTCCAGACGCCATTTTACTATTGACCCACATTAGCGGTTAGCCTCTTGCTGCAAACCCTTAATTAGCGATGCTTTAGTCCACTATTCATATCAATTATGTTATACTTAAGCATACTTATTGCATGTGAAGCAGACATGTTTAATATGTATTGTTTTAGTGATGTTTTACCAGTCACTCTCGAACGCCATTTTAAGCAGCGAACAAAAGCTAGATATCCCAGTCCATTCATTCACTACTACCGTTCACGTGTATCCCTCCGCTTTCTGTTCATTTTGCGTGTTGTTTTTGTGTGTTTTATAAGTTACTTCAATTTTTAAACACTACGATTTCTAACTGAATGTGTAGTAAATTATATTGAGCTGTTTGTATTAACTTTATGGGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4974
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106636 Nonsense 12 164 2 6
ENSDART00000135829 Nonsense 12 164 3 7
ENSDART00000137264 Nonsense 12 124 2 4
ENSDART00000144309 Nonsense 12 164 2 6
ENSDART00000145685 Nonsense 12 164 3 7

The following transcripts of ENSDARG00000059360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 594811)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 581919
GRCz11 22 619642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCGCAGATTGAACCATGCATCGCGACTGCCCCCTGGACTGCAAGGTTTA[C/A]GTTGGGAATCTGGGGAATAATGGGAATAAGTCTGAGCTGGAGAGGGCGTT
Long Flanking Sequence:
GATTAGAGTCTTTCTGCGTCTTTCAAAAGATGTTCTTCTGATGTGTAAGTGATAACAGCATTTTCAGTGTTGTGTGAACTGTCCCTTTAATAGCATTAAGTCATCTCTCTAGAGATATTCAGTCTGGTTATTGAAGTCAATGGGAAACTGGTGCTGGTGTGTCAACCAGAACAAGATGGCGGACTGAATTTATTGGTAACAAATAGTTGGTTGCTTTTTTAATATCGTGAACAACTGTTGTATTTTCATAAAAACAAAATCAAATGAGAGTTAGCCTTTAGACATTCCTCAACTGGAACAAGTACAGTTTACCATTTTCATGAAGGATTGTTCACATCAGTTGTGTTTGATCAACACTGAGACCTAAAACATCCCCACTCGCTTTAATGCTGCTGTTTTGTATTGAAACTCAAAGTCTGGTTTGCTGTTGGTTAATGCGATGTCTTGTTTCGCGCAGATTGAACCATGCATCGCGACTGCCCCCTGGACTGCAAGGTTTA[C/A]GTTGGGAATCTGGGGAATAATGGGAATAAGTCTGAGCTGGAGAGGGCGTTTGGCTACTACGGACCTCTGAGGAGCGTCTGGGTGGCCAGAAACCCTCCTGGTTTTGCGTTTGTTGAGTTTGAAGACCCTCGTGATGCCACAGACGCCGTCAGAGAGCTGGACGGGCGGTAAGTCTGGATTCACACAAGTTAAAGTTCATCTGATAATGTGTCCAGTTTACGTTTCTTCACTTTAAAAGATATTTTGAAGATAATGATAGATAATGCATTACATGTAATCTAACGGACTACGTAATCCAATTCTAAAAAATAAAATCAAGTATGTGTAATTGGTTAATTAATTTTTAAAACTGCACTTTTTTGGATTAGTCCAGCCGCCGTAGTCTGATGCGCTATCCCATCTTATGGGCTGTGGAGGAAGAATATTTGTTGACAGCTCTTTACCAACAATTGTAAACAGAACGACAGGGAAAAACATTCTAGAAGATGAGCACGTCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13439
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106636 Essential Splice Site 114 164 None 6
ENSDART00000135829 Essential Splice Site 114 164 None 7
ENSDART00000137264 Essential Splice Site 114 124 None 4
ENSDART00000144309 Essential Splice Site 114 164 None 6
ENSDART00000145685 Essential Splice Site 114 164 None 7

The following transcripts of ENSDARG00000059360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 593221)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 580329
GRCz11 22 618052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
KCCCACGGGATGACTACCGCCGCCGCAGCNNNCCGCCCCAGAGGCGCAGG[T/C]AAACCTGTCCTCCGCTCACCTGTCTCTCTGTAGCTTGTGTTTCAGAGCAA
Long Flanking Sequence:
TTGTCATCTTAAAGTAATCTACATGTAATCTACAAAAGTAATCTATGTGTAATCTACAAAAGTAATTTATATGTAATCTACAAAAGTAATTGATATGTAATCTACAAAAGTAATTTATATGTATTCTACAAAAGTAATCTATATGTAATCTATGGAAGTGGAAAAGTAATATGATGTAATCTAAAAGTAATTGACAAAAGAGCATAAAAGTAATGTCATCTAAAAGTAATCTACATGTAATCTATATTTAATCTACAAAAGTAATCTATATGTGATCAAGAGATGGACATTTTTGTAGTTAATTTAACACCAGTAACTCAGATTCTGATGTAATCAGCTGTTTGTTAATGTCGTCATGCAGGACCCTCTGTGGTTGCCGAGTGAGGGTTGAATTGTCCAATGGCGAGAAGCGGACTCGTAGCCGGGGTCCACCTCCTTCTTGGAACCGCCGCCCACGGGATGACTACCGCCGCCGCAGCAGCCCGCCCCAGAGGCGCAGG[T/C]AAACCTGTCCTCCGCTCACCTGTCTCTCTGTAGCTTGTGTTTCAGAGCAAACTAATGTGCTTCTGCCCCGTCCGCCAGTCCTGGAGGCCACTGCTCCGCCGGTGCCACGGGTCCCGGTCCGATGAGCGTCTGCCGGACATCTTTAGCTCCTCCATCTTCATTGTCATTGATAACCATTCAATAATGATTTGACTGGGCTTCTCAAATTCGATAGACAGTCATGATTGTTTGGTGTAAAAGCGGATGAGTACTCAATTAAATGCTAATCTCATAGCAATGTACCTGGGCTACATTTCACTTCAGAATCAAAGATATTTTGGGGTAAAACTTTGCAATAAGGTTCCCTTTAATAATATTACCTTACCGCTAAAGCATTCACTAATATATTACTAAAAACAAAAGTTGTATGTAATTGTTTTTATTAAGCTAACACTATTTAGCAAGAAATGCTTTGTTTAAACGGTGGCTAATATTAGCATGAACCTCTACATGTCAATACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29679
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106636 Essential Splice Site 156 164 None 6
ENSDART00000135829 Essential Splice Site 156 164 None 7
ENSDART00000137264 None None 124 None 4
ENSDART00000144309 Essential Splice Site 156 164 None 6
ENSDART00000145685 Essential Splice Site 156 164 None 7

The following transcripts of ENSDARG00000059360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 591217)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 578325
GRCz11 22 616048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGCGAGAGGAACCACAAACCATCACGATCTTTCTCCCGGTCGAGGAGG[T/C]AAGACTTGTTACTTTTTCTTGCCATCCACAATTTTAGTGATAGTACAATA
Long Flanking Sequence:
TAGGAAGCGTGGGCTTTGAGAGCTGCTCTTGCTTTCTTTCATTGTCTTCATTCTGTGGGATTGTTTGCAGTGCGTTTGTGTTGAGTTTGTCCTCTTGCTAGTGCACTACTGTGTAGACTGGAGCGTAGCGCTCTTAGCAAGGTTCTCGAGCGCTCATTGCGACTCCACCCCTGTATCAGGGCGGTGACGAGTGCGTTTGACTGTTAGCAGGCTGGAGTTTCAGGGAATTTGAGCTGCGTCTGTGTCTCGATTTGCACGTTCACTCGCTCTGCTTCTCTTCTTTCTTCAGATCTCCCAGGAGGAGGAGCTTCAGTCGTAGTCGCAGCAGGTGAGAGTTCGTGCAACTTTCCGAACGCCTACATGAAACGTCTCTGTTGTGTGTTATTAACGTGCGGTTCTGCACTCTGCCTAGATCTTTCTCCAGAGAACGCAGAAGGGAGCGATCTCTGTCCCGCGAGAGGAACCACAAACCATCACGATCTTTCTCCCGGTCGAGGAGG[T/C]AAGACTTGTTACTTTTTCTTGCCATCCACAATTTTAGTGATAGTACAATACCTCTTGTGTATTTGTTTAAATTAGGACAGCACGGTTATCAGATTATTATCACGATAACGGTATTTGTGGTTCGCGATCAATAATTAAATATCGTCGCTATTGTTTTTTTTGTTTTTTTTCGAGGAATGCAATGTTAATAAGGTAGCCTTTGCTCCTGTTCAGTCCAAACCTCTTAAAGTAACAACACACCTCATTAACCACATTAAAAGCCACCACAAAGTGGCTGTCATCGGTGGGTTAATGCACTCAGAAATATTTTAGCACATCGAAAGTAATTAAATTACTTGTTTTTTGATTAAAACCTTTATGCCAAAGGATCAGGAATTGATCGCGCGTGCAGAAAAAACGGCAAACATCCAACACATGCATCGCTTAAAGCGAGTAAACCTAAAAGAAACAAGTTGACTTTACAAAAATAATGTAAGTAAACCCATTGTAACTTAAAATTA
Associated Phenotype:
Not determined