Busch Lab

ZMP

ENSDARG00000059355

Ensembl ID:
ENSDARG00000059355
Human Orthologues:
TRIM16, TRIM16L, TRIM25, TRIM29, TRIM47, TRIM8
Human Descriptions:
tripartite motif-containing 16 [Source:HGNC Symbol;Acc:17241]
tripartite motif-containing 16-like [Source:HGNC Symbol;Acc:32670]
tripartite motif-containing 25 [Source:HGNC Symbol;Acc:12932]
tripartite motif-containing 29 [Source:HGNC Symbol;Acc:17274]
tripartite motif-containing 47 [Source:HGNC Symbol;Acc:19020]
tripartite motif-containing 8 [Source:HGNC Symbol;Acc:15579]
Mouse Orthologues:
4933422H20Rik, Trim16, Trim25, Trim29, Trim47, Trim8
Mouse Descriptions:
RIKEN cDNA 4933422H20 gene Gene [Source:MGI Symbol;Acc:MGI:3588186]
tripartite motif-containing 16 Gene [Source:MGI Symbol;Acc:MGI:2137356]
tripartite motif-containing 25 Gene [Source:MGI Symbol;Acc:MGI:102749]
tripartite motif-containing 29 Gene [Source:MGI Symbol;Acc:MGI:1919419]
tripartite motif-containing 47 Gene [Source:MGI Symbol;Acc:MGI:1917374]
tripartite motif-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1933302]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9889 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9889
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082457 Essential Splice Site 247 540 1 2
Genomic Location (Zv9):
Chromosome 23 (position 125876)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAAACGTCCTGCTGGACAACATGACRTCCCTTATTAACACATACAAGG[T/C]GAGGAGGAGCGGCAGAAGTGCTGTAACTAGCTCAGGTTTATGGAARTCAG
Associated Phenotype:
Not determined