Busch Lab

ZMP

si:ch211-285f17.1

Ensembl ID:
ENSDARG00000059333
ZFIN ID:
ZDB-GENE-000607-77
Human Orthologue:
KIAA1217
Human Description:
KIAA1217 [Source:HGNC Symbol;Acc:25428]
Mouse Orthologue:
Etl4
Mouse Description:
enhancer trap locus 4 Gene [Source:MGI Symbol;Acc:MGI:95454]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa44090 Nonsense Mutation detected in F1 DNA Not yet available
sa44091 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 206 1306 4 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 None None 959 None 17
Genomic Location (Zv9):
Chromosome 24 (position 9343941)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9402825
GRCz11 24 9543211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCCACAATGCCACGTGAGCGAGCCGGACACACACTCCCAGCCCCTGCC[C/T]GAGCATCCTCCCCCTGCCCGAGTGCCATCTTGGAGCGGCGGGATGTCAAA
Long Flanking Sequence:
GTGGGTGGAATAATACACAAGGGTGAAGAGGCTGTACAAATGCTGTTATTGTGAAATATCAGCCAGTCAGATTCGAGAACCAGACAAAACGTTTGTATAAACACAAATATACAACCTATATCTAATTACAACCTATATTTATATTTCCATGTATCAGATTTCTATATAGGTCAGGGAGACCCAAAAACCACTTTAGACTAGACAAAGCTCTTTAATTTCAGCTGTTTTTCACATTTTTTCTCATATACAGTGAAATCTTACATCCATTTTCTCTCGTTCAGGTTCACAGGGAAATGATATTTGCTGGACGGGATGGTCACCCACTCCGGAACCCCCCAATGGGTCCTCCACCCCCCCACATGCAAGGCTCCATGTCACCCACTACACCTCACGGGATGCCTCCCTCTCCATCTCGAATTCCCTTTGGCCCGCGAAACCCAGGTGGAGGTGTTGCCACAATGCCACGTGAGCGAGCCGGACACACACTCCCAGCCCCTGCC[C/T]GAGCATCCTCCCCCTGCCCGAGTGCCATCTTGGAGCGGCGGGATGTCAAACCTGACGAGGATGTAGCTGCGAAGACCATGTCTCTGAACACCAGAGCTGAAAGTCATTACGCCGACCCTTATATGTTACTTCACCATGCCCCGCCCCCTGACACAGTAGACCACGCCTACCACCGTGCTACCATGCGCTCTTACAGCAACCCCAGCGTTCCCTTGGAGCCCCCAGACCATCTCTTCCGACAGAAAAGCAGGAATAGCCAACTCCCCATGCTTGGCTCCAAAACCCCGCCCCCTTCCCCGCACCGAATGGGTGAGATGAGAATGGTGGACATCCATACGGTCCAACCGCAGAGCTCCATGACTCTGGAAAGGGCTTCACCTGTTAGACAATCATTTCGGAAGGAGGCTCCTCCTATGGATGCCATGGTAAAGGCAAGAGGGGGAATGGGGTCTCCAGCCACCCCCGATCTTCAGGTTCACAATCCTCTGGCGCCCCCGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19339
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 237 1306 4 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 None None 959 None 17
Genomic Location (Zv9):
Chromosome 24 (position 9344034)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9402918
GRCz11 24 9543304
KASP Assay ID:
554-6206.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCAAACCTGACGAGGATGTAGCTGCGAAGACCATGTCTCTGAACACC[A/T]GAGCTGAAAGTCATTACGCCGACCCTTATATGTTACTTCACCATGCCCCG
Long Flanking Sequence:
TGTATAAACACAAATATACAACCTATATCTAATTACAACCTATATTTATATTTCCATGTATCAGATTTCTATATAGGTCAGGGAGACCCAAAAACCACTTTAGACTAGACAAAGCTCTTTAATTTCAGCTGTTTTTCACATTTTTTCTCATATACAGTGAAATCTTACATCCATTTTCTCTCGTTCAGGTTCACAGGGAAATGATATTTGCTGGACGGGATGGTCACCCACTCCGGAACCCCCCAATGGGTCCTCCACCCCCCCACATGCAAGGCTCCATGTCACCCACTACACCTCACGGGATGCCTCCCTCTCCATCTCGAATTCCCTTTGGCCCGCGAAACCCAGGTGGAGGTGTTGCCACAATGCCACGTGAGCGAGCCGGACACACACTCCCAGCCCCTGCCCGAGCATCCTCCCCCTGCCCGAGTGCCATCTTGGAGCGGCGGGATGTCAAACCTGACGAGGATGTAGCTGCGAAGACCATGTCTCTGAACACC[A/T]GAGCTGAAAGTCATTACGCCGACCCTTATATGTTACTTCACCATGCCCCGCCCCCTGACACAGTAGACCACGCCTACCACCGTGCTACCATGCGCTCTTACAGCAACCCCAGCGTTCCCTTGGAGCCCCCAGACCATCTCTTCCGACAGAAAAGCAGGAATAGCCAACTCCCCATGCTTGGCTCCAAAACCCCGCCCCCTTCCCCGCACCGAATGGGTGAGATGAGAATGGTGGACATCCATACGGTCCAACCGCAGAGCTCCATGACTCTGGAAAGGGCTTCACCTGTTAGACAATCATTTCGGAAGGAGGCTCCTCCTATGGATGCCATGGTAAAGGCAAGAGGGGGAATGGGGTCTCCAGCCACCCCCGATCTTCAGGTTCACAATCCTCTGGCGCCCCCGACAGACCCTCAAACACGGTAAGTTCATTTATTCAGGAGCAAACTGGGCTTTCCAAGCATGAAAATAACAAACGGTCCATCCCAGGATATATTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44091
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Essential Splice Site 377 1306 None 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 Essential Splice Site 312 959 None 17
Genomic Location (Zv9):
Chromosome 24 (position 9344457)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9403341
GRCz11 24 9543727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGGTTCACAATCCTCTGGCGCCCCCGACAGACCCTCAAACACGG[T/C]AAGTTCATTTATTCAGGAGCAAACTGGGCTTTCCAAGCATGAAAATAACA
Long Flanking Sequence:
GCCCGAGTGCCATCTTGGAGCGGCGGGATGTCAAACCTGACGAGGATGTAGCTGCGAAGACCATGTCTCTGAACACCAGAGCTGAAAGTCATTACGCCGACCCTTATATGTTACTTCACCATGCCCCGCCCCCTGACACAGTAGACCACGCCTACCACCGTGCTACCATGCGCTCTTACAGCAACCCCAGCGTTCCCTTGGAGCCCCCAGACCATCTCTTCCGACAGAAAAGCAGGAATAGCCAACTCCCCATGCTTGGCTCCAAAACCCCGCCCCCTTCCCCGCACCGAATGGGTGAGATGAGAATGGTGGACATCCATACGGTCCAACCGCAGAGCTCCATGACTCTGGAAAGGGCTTCACCTGTTAGACAATCATTTCGGAAGGAGGCTCCTCCTATGGATGCCATGGTAAAGGCAAGAGGGGGAATGGGGTCTCCAGCCACCCCCGATCTTCAGGTTCACAATCCTCTGGCGCCCCCGACAGACCCTCAAACACGG[T/C]AAGTTCATTTATTCAGGAGCAAACTGGGCTTTCCAAGCATGAAAATAACAAACGGTCCATCCCAGGATATATTAGCACCCATGACTTGTTCATTTTCTAACTCTGCATCGGTTCGTTGTCCTTCTCTGCATCATTACATTTCCTAACCGCATCCAAAACCCATCGACTGTGTCTTGTCTAAATACTAGCAGCCATTATTATTATGTTTGTGTATATTATTTTGGCTTGAAAAAAACTTTTTAGGTTGGTTTGAATTCAAAAATACAAATAATAATAATAATAAAGACATTGAGTCTACACTGTAAAAAATATCTGTTAATTAGTAGTTTCCGTATTTTGTGTTTCATAAGTGTTTTCCGTTTATTTACGGTTGTGAATTGCATTATGGGAGCTTGATTTCTGCTCTGTCGACATTTGATGTTCAAAATTTAACTACAGTTGGGATGGGCGATGTTGACCAATTGGGCATTGATGTCTAATGTGAACCTTCGTGATGGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5807
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 702 1306 11 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 Nonsense 602 959 13 17
ENSDART00000082422 Nonsense 702 1306 11 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 Nonsense 602 959 13 17
Genomic Location (Zv9):
Chromosome 24 (position 9373806)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9432690
GRCz11 24 9573076
KASP Assay ID:
554-3496.1 (used for ordering genotyping assays)
KASP Sequence:
CAAACCCTGTGGTGATCCACCRTGCTCAGGCCTCTCCAGTAGCATCACAA[C/T]AATCCCAGCAATCAACAGCACCTTCACCCATCCCTACACAAAGAAGAGAG
Long Flanking Sequence:
CCTACCAGAAGGCACAGAAAGCACCTACTGGCCCATTTCTATCAGCTGATAACCACTGATAATGCCATTCATTCGAACTGGCTGTAAATATTGCAGTCTTTTTTCTATTTTAAAAAGCCTCCACATATGAGGAAATCAACATTGATCAGAATATTTCAATACTTTAAAACACTGCAGATTATTCTTTTTTGCAGGCCAAAACAATTGATAGAAATCATAAAAATAAGGGTGTGCTTGTGTATGTGTTGAGTTTTGTACATAAAAAAAAAACCTCATTGATTTTTTTTGCAATTGATTTGTTCTCTAGGTGTGCCACCGATAACCTGCTTAAACCCACTGATCAGGTTTGCTCAACACCTCCTGCCTCTGAAAAACCAGAACTTATTGAATCCCCAGAACCTGCACCGGTCACACCTCAGAGCTCCATCGTGAGGTCAGAGGTTATGACCTCAAACCCTGTGGTGATCCACCATGCTCAGGCCTCTCCAGTAGCATCACAA[C/T]AATCCCAGCAATCAACAGCACCTTCACCCATCCCTACACAAAGAAGAGAGTCTACACCGTCACCCACTAAACAGCTCAGAAAACCCTCACTGGAACAAACACAAAACAACACCAGTAATGGAGTTTCTGCTAATGGCGTACATGGCAAGGGTCCTTCTCCAAACCTGATCATTGAGGAGATCCACGCCAGCCACAGCAAGAACAAGAACAGAGCTGTGTCCATAGAGGTAAACGTTGCACACATTTTCAGGTCAAATGTGTTGTGGATAGATTAGTTTCTAAATTGGACAAAAGTGGCTAGACAAAATTGAATCAGGCGTTGTCACAAGACAAGCTCATTTTAGGCCTTGGTTTAACTCAATTTTGACTAATTGTGTGGGTACTACACTTTCCTTTTGGATGGCAGAGTAATACACTATTAGCATACATACTAAAATACAGTCTTTTAGCAGTGGTTTTCAAAGTGGGGGTTGCTTGGCGATGTCCAAAAATCCAATTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3282
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 702 1306 11 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 Nonsense 602 959 13 17
ENSDART00000082422 Nonsense 702 1306 11 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 Nonsense 602 959 13 17
Genomic Location (Zv9):
Chromosome 24 (position 9373806)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9432690
GRCz11 24 9573076
KASP Assay ID:
554-3496.1 (used for ordering genotyping assays)
KASP Sequence:
CAAACCCTGTGGTGATCCACCRTGCTCAGGCCTCTCCAGTAGCATCACAA[C/T]AATCCCAGCAATCAACAGCACCTTCACCCATCCCTACACAAAGAAGAGAG
Long Flanking Sequence:
CCTACCAGAAGGCACAGAAAGCACCTACTGGCCCATTTCTATCAGCTGATAACCACTGATAATGCCATTCATTCGAACTGGCTGTAAATATTGCAGTCTTTTTTCTATTTTAAAAAGCCTCCACATATGAGGAAATCAACATTGATCAGAATATTTCAATACTTTAAAACACTGCAGATTATTCTTTTTTGCAGGCCAAAACAATTGATAGAAATCATAAAAATAAGGGTGTGCTTGTGTATGTGTTGAGTTTTGTACATAAAAAAAAAACCTCATTGATTTTTTTTGCAATTGATTTGTTCTCTAGGTGTGCCACCGATAACCTGCTTAAACCCACTGATCAGGTTTGCTCAACACCTCCTGCCTCTGAAAAACCAGAACTTATTGAATCCCCAGAACCTGCACCGGTCACACCTCAGAGCTCCATCGTGAGGTCAGAGGTTATGACCTCAAACCCTGTGGTGATCCACCATGCTCAGGCCTCTCCAGTAGCATCACAA[C/T]AATCCCAGCAATCAACAGCACCTTCACCCATCCCTACACAAAGAAGAGAGTCTACACCGTCACCCACTAAACAGCTCAGAAAACCCTCACTGGAACAAACACAAAACAACACCAGTAATGGAGTTTCTGCTAATGGCGTACATGGCAAGGGTCCTTCTCCAAACCTGATCATTGAGGAGATCCACGCCAGCCACAGCAAGAACAAGAACAGAGCTGTGTCCATAGAGGTAAACGTTGCACACATTTTCAGGTCAAATGTGTTGTGGATAGATTAGTTTCTAAATTGGACAAAAGTGGCTAGACAAAATTGAATCAGGCGTTGTCACAAGACAAGCTCATTTTAGGCCTTGGTTTAACTCAATTTTGACTAATTGTGTGGGTACTACACTTTCCTTTTGGATGGCAGAGTAATACACTATTAGCATACATACTAAAATACAGTCTTTTAGCAGTGGTTTTCAAAGTGGGGGTTGCTTGGCGATGTCCAAAAATCCAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17839
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082422 Nonsense 729 1306 11 19
ENSDART00000132688 None None 57 None 3
ENSDART00000132724 Nonsense 629 959 13 17
Genomic Location (Zv9):
Chromosome 24 (position 9373887)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9432771
GRCz11 24 9573157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCTACACAAAGAAGAGAGTCTACACCGTCACCCACTAAACAGCTCAGR[A/T]AACCCTCACTGGANNNNNNACAAACACAAAACAACACCAGTAATGGAGTYTCTGCT
Long Flanking Sequence:
CTGTAAATATTGCAGTCTTTTTTCTATTTTAAAAAGCCTCCACATATGAGGAAATCAACATTGATCAGAATATTTCAATACTTTAAAACACTGCAGATTATTCTTTTTTGCAGGCCAAAACAATTGATAGAAATCATAAAAATAAGGGTGTGCTTGTGTATGTGTTGAGTTTTGTACATAAAAAAAAAACCTCATTGATTTTTTTTGCAATTGATTTGTTCTCTAGGTGTGCCACCGATAACCTGCTTAAACCCACTGATCAGGTTTGCTCAACACCTCCTGCCTCTGAAAAACCAGAACTTATTGAATCCCCAGAACCTGCACCGGTCACACCTCAGAGCTCCATCGTGAGGTCAGAGGTTATGACCTCAAACCCTGTGGTGATCCACCATGCTCAGGCCTCTCCAGTAGCATCACAACAATCCCAGCAATCAACAGCACCTTCACCCATCCCTACACAAAGAAGAGAGTCTACACCGTCACCCACTAAACAGCTCAGA[A/T]AACCCTCACTGGAACAAACACAAAACAACACCAGTAATGGAGTTTCTGCTAATGGCGTACATGGCAAGGGTCCTTCTCCAAACCTGATCATTGAGGAGATCCACGCCAGCCACAGCAAGAACAAGAACAGAGCTGTGTCCATAGAGGTAAACGTTGCACACATTTTCAGGTCAAATGTGTTGTGGATAGATTAGTTTCTAAATTGGACAAAAGTGGCTAGACAAAATTGAATCAGGCGTTGTCACAAGACAAGCTCATTTTAGGCCTTGGTTTAACTCAATTTTGACTAATTGTGTGGGTACTACACTTTCCTTTTGGATGGCAGAGTAATACACTATTAGCATACATACTAAAATACAGTCTTTTAGCAGTGGTTTTCAAAGTGGGGGTTGCTTGGCGATGTCCAAAAATCCAATTCATTTTATTAAACTATTAGAATATTTATTTTAGCCATAACAAAATAACAAAGTTGTAGTTAATTGTAAGATTGTTAACATGTT
Associated Phenotype:
Not determined