Busch Lab

ZMP

gata2a

Ensembl ID:
ENSDARG00000059327
ZFIN ID:
ZDB-GENE-980526-260
Description:
GATA-binding protein 2a [Source:RefSeq peptide;Acc:NP_571308]
Human Orthologue:
GATA2
Human Description:
GATA binding protein 2 [Source:HGNC Symbol;Acc:4171]
Mouse Orthologue:
Gata2
Mouse Description:
GATA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:95662]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3800
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082420 Essential Splice Site 7 193 1 4
ENSDART00000082425 Missense 269 456 4 6
ENSDART00000082420 Essential Splice Site 7 193 1 4
ENSDART00000082425 Missense 269 456 4 6

The following transcripts of ENSDARG00000059327 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 3916107)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3834611
GRCz11 11 3853998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATAAATTTCCCTTTGCTTTTCCTCCACTTGAATTCTGCACAGAGGGGC[G/A]TGAATGTGTGAACTGTGGAGCCACCTCCACCCCGCTGTGGCGGCGGGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8358
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082420 Essential Splice Site 7 193 1 4
ENSDART00000082425 Missense 269 456 4 6
ENSDART00000082420 Essential Splice Site 7 193 1 4
ENSDART00000082425 Missense 269 456 4 6

The following transcripts of ENSDARG00000059327 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 3916107)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3834611
GRCz11 11 3853998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATAAATTTCCCTTTGCTTTTCCTCCACTTGAATTCTGCACAGAGGGGC[G/A]TGAATGTGTGAACTGTGGAGCCACCTCCACCCCGCTGTGGCGGCGGGATG
Associated Phenotype:
Not determined