Busch Lab

ZMP

si:ch211-241b2.5

Ensembl ID:
ENSDARG00000059310
ZFIN ID:
ZDB-GENE-081104-192
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A5Z7]
Human Orthologues:
CD274, PDCD1LG2
Human Descriptions:
CD274 molecule [Source:HGNC Symbol;Acc:17635]
programmed cell death 1 ligand 2 [Source:HGNC Symbol;Acc:18731]
Mouse Orthologues:
Cd274, Pdcd1lg2
Mouse Descriptions:
CD274 antigen Gene [Source:MGI Symbol;Acc:MGI:1926446]
programmed cell death 1 ligand 2 Gene [Source:MGI Symbol;Acc:MGI:1930125]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43560 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37203 Nonsense Mutation detected in F1 DNA Not yet available
sa32323 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43560
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082395 Essential Splice Site 274 502 6 9
ENSDART00000139098 Essential Splice Site 268 465 5 8
Genomic Location (Zv9):
Chromosome 21 (position 2498349)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2374386
GRCz11 21 2400210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATAATCTATCATATAAACGTGTGTGTGACCTCTGCTTTATCTGTTGAC[A/G]GGTCAGAAAAACAGAAGAAACGAAGCCTCTAAATGTGCTTACCTCTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37203
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082395 Nonsense 452 502 9 9
ENSDART00000139098 Nonsense 446 465 8 8
Genomic Location (Zv9):
Chromosome 21 (position 2503277)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2369458
GRCz11 21 2395282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAGTCTCTTAAAGGGCCGGAGGACTGTTTGCTGATCCTCGATGATTA[T/A]CAAGAGGGAAATAAAGACTTGGAGGAGTTTTTAAAGGACCATCAGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32323
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082395 Nonsense 454 502 9 9
ENSDART00000139098 Nonsense 448 465 8 8
Genomic Location (Zv9):
Chromosome 21 (position 2503281)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2369454
GRCz11 21 2395278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTCTTAAAGGGCCGGAGGACTGTTTGCTGATCCTCGATGATTATCAA[G/T]AGGGAAATAAAGACTTGGAGGAGTTTTTAAAGGACCATCAGACGTGTCGA
Associated Phenotype:
Not determined