Busch Lab

ZMP

hoxd9a

Ensembl ID:
ENSDARG00000059274
ZFIN ID:
ZDB-GENE-990415-121
Description:
Homeobox protein Hox-D9a [Source:UniProtKB/Swiss-Prot;Acc:Q9PWM6]
Human Orthologue:
HOXD9
Human Description:
homeobox D9 [Source:HGNC Symbol;Acc:5140]
Mouse Orthologue:
Hoxd9
Mouse Description:
homeobox D9 Gene [Source:MGI Symbol;Acc:MGI:96210]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa18397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18397
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082354 Nonsense 99 262 1 2
Genomic Location (Zv9):
Chromosome 9 (position 1956141)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1964545
GRCz11 9 1965342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTTCACCAGACCCATCTTTCAGACAACAGATACGTCCGATCCTGGATA[G/T]AGCCAGTCGCAAACCATATCTCTTTAACGRGCTTCCACYCCAACAGTCGG
Associated Phenotype:
Not determined