Busch Lab

ZMP

LOC557467

Ensembl ID:
ENSDARG00000059272
Human Orthologue:
KBTBD11
Human Description:
kelch repeat and BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:29104]
Mouse Orthologue:
Kbtbd11
Mouse Description:
kelch repeat and BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1922151]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa15491 Nonsense Available for shipment Available now
sa8879 Nonsense Mutation detected in F1 DNA Not yet available
sa12661 Nonsense Available for shipment Available now
sa12654 Nonsense Available for shipment Available now
sa2926 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa15491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 33 468 1 2
Genomic Location (Zv9):
Chromosome 17 (position 27193396)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25271831
GRCz11 17 25290232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AYAAATCAGTATTAGCTGARAAGAGCGATTAYTTTAAGGCCAGGCTTTCT[C/T]GAGACATCCTCAMAGTAAAAGGAATGAGCTACAAGACCTTATCAGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 98 468 1 2
Genomic Location (Zv9):
Chromosome 17 (position 27193593)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25272028
GRCz11 17 25290429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGCWGCTATTGATACYATTTCCACACAGATCACACCTGAGAACTGCTA[C/A]GAAATCCTAACGATYGCTAAAAAGCAACGATTAAATGAACTGAAAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12661
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 118 468 1 2
ENSDART00000082352 Nonsense 118 468 1 2
Genomic Location (Zv9):
Chromosome 17 (position 27193651)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25272086
GRCz11 17 25290487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACGATYGCTAAAAAGCAACGATTAAATGAACTGAAAGAAACCRCCTAT[C/T]GATTCATGAGTGACAACTTTCTGCAGGTTCTRAAAGATCCAGCTGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 118 468 1 2
ENSDART00000082352 Nonsense 118 468 1 2
Genomic Location (Zv9):
Chromosome 17 (position 27193651)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25272086
GRCz11 17 25290487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACGATYGCTAAAAAGCAACGATTAAATGAACTGAAAGAAACCRCCTAT[C/T]GATTCATGAGTGACAACTTTCTGCAGGTTCTRAAAGATCCAGCTGTCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4007
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 258 468 1 2
Genomic Location (Zv9):
Chromosome 17 (position 27194073)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25272508
GRCz11 17 25290909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAAAGTCTCAGACAGGGTTTACTGCTATAATCCTGTCACAGACCGCTG[G/A]AGTGAAGTTAGACCCAYGAACCAAGCCCGATCACAACTCAAACTCGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2926
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082352 Nonsense 334 468 1 2
Genomic Location (Zv9):
Chromosome 17 (position 27194301)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25272736
GRCz11 17 25291137
KASP Assay ID:
554-3293.1 (used for ordering genotyping assays)
KASP Sequence:
GCCACTACATGTAACGGCGAGCTGTATGTCTCTGGAGGATCTCTGTTCTA[T/A]CGGTTGCTAAAATATGACCCTAAGAGGGACGAATGGCAGGAGTGTCCGTA
Associated Phenotype:
Not determined