Busch Lab

ZMP

abhd13

Ensembl ID:
ENSDARG00000059209
ZFIN ID:
ZDB-GENE-051120-54
Description:
Abhydrolase domain-containing protein 13 [Source:UniProtKB/Swiss-Prot;Acc:Q32LS6]
Human Orthologue:
ABHD13
Human Description:
abhydrolase domain containing 13 [Source:HGNC Symbol;Acc:20293]
Mouse Orthologue:
Abhd13
Mouse Description:
abhydrolase domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:1916154]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41347 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41347
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL7_02_E5
KASP Assay Location:
Unknown
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082260 Essential Splice Site None 337 1 2
Genomic Location (Zv9):
Chromosome 9 (position 5362403)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 5502443
GRCz11 9 5350869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGTAAACCCAGCTCCCTGAAGATGTGCCGCTGAAGAATGCGCTAGATG[T/A]GAGTAGTTTCGTATCAGGCTGTCAGCAGATGTGTGCTAGACATTGCTAGC
Long Flanking Sequence:
GTTATTTTTCCTTAAACTCTGGTTTAACACTAAGATTAGTTGAGATTTTATTTTGAATTAGATCTTCTTTCTGATTACTGAGCTCACATATTTAATTTAGTATCATCCTGCTTTTTGCTAATTGTGTTAACGTTAGCTATATTTTCACTATTCATTTTTTATTATACACAATTTGCTAGATTTTCATTTTCGCAAGCTGGCACGTGTGTTTTTAACACATATAAGTTTACAATTTATTAATTTTATGTGTACTGGAAACGTAACGAACGCCGAAGAACCACTGAGGTGGCAGAACGTGTTGTGCGTCAGCAGAAGGTTCCGCTGTTTCCGCCCGGAACTTCCTCGAAGCGACACCGGTGTCATCAGCAGCCGTCCGGCTAGATTTGCTGCTAGCCACAGTGTATCAGCTGTCGTTTGACGGGATGTTCGTATAGATGACCGTTTGCCCTGCTCGTAAACCCAGCTCCCTGAAGATGTGCCGCTGAAGAATGCGCTAGATG[T/A]GAGTAGTTTCGTATCAGGCTGTCAGCAGATGTGTGCTAGACATTGCTAGCAGCTGAATTAGCTGTGTACTGTACATAAAGTCCAGAGGGGGGAAACGCTGCTGTCAAAATCAATCTGTCATCGTCACATTTATGATTCCTGTCAGCTTAGTTTGGACTTCGGGGTGTTTCTCCCTTACAATGACAACAGCTGGTAGTAAAGCGAAACATGAAGGGATTTAGTGCGGATCTGCCGTTTACTGTATGGCGTGTTATTGGGGTCAGGCTCGTTTTTTATCGCGTTGCATTTCGAAAGTAATGTTAATATGGGAAATAAATAATTCTAAATGTCTAAATAATAAGTAAATTTTGCGAGGGAATGCAGGTTTCATCTGCATTCTTGTGTAGTTGAGTGATCAAGACTGGACCTGGCCCCTAAACAGCCTGTGGGCTCCAGACTGGAGTGAGGTAAAGTTGGTTTTATATTCACACATTCGGACTTTCTCCTTAACAATTAATAGT
Associated Phenotype:
Not determined