Busch Lab

ZMP

tlk1b

Ensembl ID:
ENSDARG00000059190
ZFIN ID:
ZDB-GENE-030131-4933
Description:
Serine/threonine-protein kinase tousled-like 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q90ZY6]
Human Orthologue:
TLK1
Human Description:
tousled-like kinase 1 [Source:HGNC Symbol;Acc:11841]
Mouse Orthologue:
Tlk1
Mouse Description:
tousled-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2441683]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1341 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009936 Essential Splice Site 276 756 9 21
ENSDART00000082219 Essential Splice Site 276 756 9 21
Genomic Location (Zv9):
Chromosome 6 (position 3712689)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3736993
GRCz11 6 3897813
KASP Assay ID:
554-1255.1 (used for ordering genotyping assays)
KASP Sequence:
GCGTCTGAACAAATGCACTACGATGAGTAAAAAACTCCTGATTGAGAAGG[T/C]AAGCTGTGTCTTATGTGCTTGCAGMTGTGTATACATRTGCCGATATATAA
Long Flanking Sequence:
CCAGGAGAAAACAAATATAGGAAATACTGTGAAAATGTCCTTGCTCTGTTAAATATCATTTGGGAAATATTTATAAAAGAAAATAAACAAAATTCACTGGAGGGCTAATCATTTTGACTTCAGCTGTATGATGCACTGAGACTGATCTCTGCCGTTCTCCACATTTTACTCGTTTTCTCCTCTTCTCAGACGGATTTGACACTGTTGAAACTGGCTGCACTTGAGAGCAATAAGAATCTTGACCTTGAGAAGAAGGAGGGCAGAATAGATGATCTACTCAGGGTGAGGAACAGACAGATGAGTTTCACCTGCCCTTGAGCTTCATTTTGCGCTTTTGGAAGCGGCATCTGAGTGCAGACTGTAAGTGTTTCTGATGTTTTCCACCCAGGCGAACTGTGACCTCCGCAGACAGATAGATGAGCAGCAGAAACTGCTGGAACGTTTCAAGGAGCGTCTGAACAAATGCACTACGATGAGTAAAAAACTCCTGATTGAGAAGG[T/C]AAGCTGTGTCTTATGTGCTTGCAGCTGTGTATACATGTGCCGATATATAATTTAGTAAGTCAATATATTGTGTTCAGGAACATGCATGATATTGATGTCATGGGCACTTCAAAATAAAGTGAATAGTTATGTATTATTTTATCTTTTAGAGTGCCTGTTATAGAAATATTCAGTGGTTGTTTATCACTGCAGATGAAAATAAGACTTAAAGGGCCATGAAACCCCCTTGTTTCAGCAGGGTGTTTTCACACCTCTACTTTGGAAAAAGTCAGAAAAGTGGGCGTGTCCATCTCTGTTTAGGGGGAGTGTCGGAGGAAGAAAAGAGGCATGGTGTGGGAGTGTCTATTTGGGTGCGCTGAGTTTCAGAGTCAAAACACACACCCAACAGGGGAGAAAGTGACTGTGTTTACATGGACATCTGTAGTTGAATTATTTGCCGAATTATTAAATGGTGGACTTTAACTTCAGTTTGGCTCTTTCATTCAGGGAATTCATTCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8217
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009936 Nonsense 282 756 10 21
ENSDART00000082219 Nonsense 282 756 10 21
Genomic Location (Zv9):
Chromosome 6 (position 3710416)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3734720
GRCz11 6 3895540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGTTGACCCTCAAGTGTGTTTTCGTCTCACTAGARCACTCAAGAGAAA[C/T]AGTCCTGCCGGGAAAAGAGCATGCAGGACCGGCTGCGTCTRGGACACTTC
Long Flanking Sequence:
CTGCGTTGCAGGAAATGGGGCAGGGCTTGAGTTCCATATTGACATAACGCCGACACGGCTAAAGACTCGTTACAGCGGCAATTCATTTGAACCATTCTGAGTCGACTCTTTCATAGATGAATCAATAGTTTTAAACATTGTGCACTTTAAGATTTAAGCCTTAGCTGGATATTTCACTTCACTTAGAGCTGTCACACATTACATGGAAGGACATTTTCAAAAACCCAAAGGCTCTTATCCTTTTACAGTTAGGTTGCATTTGACTTCAGGTAAGTTGAATCTGCAAAAGCATTTATTAATCTTAGGTGATGTTAAAACCTTATAGTGCATTTAAAAAAGTAATATGTGTTTTATGTTAATAGCTTTAAAATCAGTTTTTCTGTTTTTTTTTTATTATTTTTTTTTTTTTACTAATTTTAAAATTGTAACTAATAAATGTGGATAATGGCAGTTGTTGACCCTCAAGTGTGTTTTCGTCTCACTAGAGCACTCAAGAGAAA[C/T]AGTCCTGCCGGGAAAAGAGCATGCAGGACCGGCTGCGTCTAGGACACTTCACCACAGTCCGACATGGGGCATCCTACTCGGAACAGTGGACTGATGGTTATGCCTTCCAGAACCTCGTCAAGTAAGAGTCTCACACAAAGTCGGAGTTTTTCCTATCCAGTCTTTTTTTATTTACAGGAACACTTCACTTTGTTTGGAAATTGGCTCAATGAGTACAATATTGAAATTTTAACTGATATAATCTTGATTTTTATGTTCCTGTTTGCAAAAAAAAAAAAAAAAAACCTCTTCTGAACTGGCAGAAATATTTCAAATTTATCAGTTTTTATATTTCAGGTTGATAATCAATGAAAGACCTGACAGCAGAATAGAACTTAAATAAAACATCAAGATTAAACAGTGAATTACTTTTGATATTGTATGTAAATAATTATACTCTATATTAGCTCTCTTTTTATTTTTTATTTATTTATTTATTATTATTTATTTATTTACTTATT
Associated Phenotype:
Not determined