Busch Lab

ZMP

si:dkey-218f9.1

Ensembl ID:
ENSDARG00000059171
ZFIN ID:
ZDB-GENE-070705-373
Description:
UPF0490 protein C1orf201 homolog [Source:UniProtKB/Swiss-Prot;Acc:A5WUY6]
Human Orthologue:
C1orf201
Human Description:
chromosome 1 open reading frame 201 [Source:HGNC Symbol;Acc:28070]
Mouse Orthologue:
4930555I21Rik
Mouse Description:
RIKEN cDNA 4930555I21 gene Gene [Source:MGI Symbol;Acc:MGI:1926056]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23417 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29133
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082215 Nonsense 55 320 4 9
Genomic Location (Zv9):
Chromosome 19 (position 4816539)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4090100
GRCz11 19 4020926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTCATCCATCCATCTATCAGAATGAGAGTCCAGGGCCTGGTTCATA[T/A]CTCTCACATTCGCCTGCTGAATGCTGCAGTCCTTCATTCTCTAAGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23417
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082215 Nonsense 90 320 5 9
Genomic Location (Zv9):
Chromosome 19 (position 4816282)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4089843
GRCz11 19 4020669
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTTTTTTCATCTGAAGGGTGGTCGTGTGCCCAGGAGCTTTCAGAGAT[T/A]AAGCCCAGGACCCGATGCTTATAACCTTCAGATGTCTCTGCTTCACAAGC
Associated Phenotype:
Not determined