Busch Lab

ZMP

zgc:63514

Ensembl ID:
ENSDARG00000059158
ZFIN ID:
ZDB-GENE-030131-8356
Description:
four and a half LIM domains 3 [Source:RefSeq peptide;Acc:NP_001093448]
Human Orthologue:
FHL3
Human Description:
four and a half LIM domains 3 [Source:HGNC Symbol;Acc:3704]
Mouse Orthologue:
Fhl3
Mouse Description:
four and a half LIM domains 3 Gene [Source:MGI Symbol;Acc:MGI:1341092]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16053 Essential Splice Site Available for shipment Available now
sa13682 Nonsense Available for shipment Available now
sa29137 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3044
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Nonsense 7 290 1 5
ENSDART00000132380 Nonsense 7 290 3 7
ENSDART00000139225 Nonsense 7 225 2 5
Genomic Location (Zv9):
Chromosome 19 (position 4898225)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4171786
GRCz11 19 4102612
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGAGKTYGAGACGAGCGGAGCGTCATGTCAGAGCCGTTTGAYTG[T/A]GAAAGCTGTAAAGAGTCTCTGTACGGACAGAAATACATCCAGGTGGACGA
Long Flanking Sequence:
GATTACAGAGAGTATAAACTGCTCTGCGCTCCTGTCAGATGTAGACCGATTTTCATCAGAACGGCTAACCGCTAGTCAGCCAAACACTGCACGATCACCTCACAGCAAGAAGGTCGCTGGTTCTGTGTTAACCTGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAACACATGCGCTATAGGTGAACTGAATAAGCTAAACTGGCCGTAGTGTGTGAGTATGTGTGAATGCAAGAGTGTATGGGTGTTTCCCAATGTTGGGCTGCGGCTGGAAGGGCATCCGCTGTGTAAAACATATGCTGGAATAGTTGGTGGTTCATTCCGCTGTGGCGACCCCAGATTAATAAAGGGATTAAGCCGAAAAGAAAACATATGAACGAATAATAATGTTTCACTGTGTTTTGCTCTAGGATTTGAGCGCATCTCGATCTTCTGGCTGTGCTGTGTGTGAGGTCGAGACGAGCGGAGCGTCATGTCAGAGCCGTTTGACTG[T/A]GAAAGCTGTAAAGAGTCTCTGTACGGACAGAAATACATCCAGGTGGACGACAAGCCTCACTGCGTGCCCTGCTACGACCGGCTGCATGCCAACACCTGCCACGAGTGCAAAGAGCTGATCGAACACAACTCACGGGTGAGGTTTCAAAATACACGTGCAATCAAAACTAACCGTGTTGATTTTGTTTGCTCACACTGCTAGTTTTGTGGTGAACAATTCATCTGAGCATGTCATTAAGTAGGGTTAATTATCGTTTGGGTTTTTTCGATACCGGTACTAAATCGATACTTTTAAAATGGTACTGGTGCCAAAACGGTGCCTGAATCAATCCTTTTTCACACTTAGTTCACACATATCTTATGATTGATTATAAGCAAGTTTGGCATGCTGTCCCGGGAGAGAGCCCTGAGCTCGAAGGTTCTTGAGCCCTGGGCTCCCTCTCGTTGGAGGAAGAGAGGGGAGCCTTGAGCTCAGGTAGATCTCGACAACTCCCCCTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16053
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Essential Splice Site 110 290 2 5
ENSDART00000132380 Essential Splice Site 110 290 4 7
ENSDART00000139225 Essential Splice Site 110 225 3 5
Genomic Location (Zv9):
Chromosome 19 (position 4891886)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4165447
GRCz11 19 4096273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATGAGTTTTCTTCTAATTGTGTGGCCTGCGGGAAGACWGTGATGCCAG[G/A]TAACCTTMACACAMACACGYATATGCTAGWATTTTATTTWTATACACACA
Long Flanking Sequence:
GGAATGAAGGAAGATAACTGAATGCTTTTAAGAATACTTCGTTTACACATCCCTGCACAAATTGCATGTAAGCACATTCACTTTTCACTGTGTAATACTCACTCACTACTCTTGAGTACTTTTGAAAGGTCTACTTTTTACTCATACTTTGAGTAATATTTACAACTCTCTACTTGCACTACATTTTTGGGCAAGTAATGGTACTTGTACTTGAGTATGATTTTTCAGTACTCTTTCCACCACTGAGGGCTAATAATTTTGACCTCAACTGTACATCTTATAAGAGTGTGTTCATGTGTTTCTCCTGTGCTGTGTGTGTGTTCAGGAGCTGTATCATGAGGACAGGCATTATCATGAGCAGTGTTTCCGCTGCTCGCGCTGCAGTCGATCACTGGCTAAAGAGTCCTTCACCTGTCAGGAAGACGCTCTGGTGTGTAACAACTGTTACTGCAATGAGTTTTCTTCTAATTGTGTGGCCTGCGGGAAGACTGTGATGCCAG[G/A]TAACCTTCACACAAACACGTATATGCTAGTATTTTATTTTTATACACACACCTTTCGAAAGTTTGGGGTGAGTTTTTTCTTCAGGAAGGATGGCTTAAATTCAGAATACGATTCAGAATAACTGTGTAATCTCAAATAAATTCTTAAAGCACATAGAAAATATATAATATACATAGACAATAATGGGTAAAGCTATTCATTTATATACATATATTTATATACGGAAATATTTTATATTATAGTGCTCTTCAATGGAGAGATTTGAACAATTTTAAAAATACCAACTAATTTAATAACTAATTAACTTTGTCTTTGTGTCTTTTGTGCTATGATGACAGTATATAATATTTGTGTATTTTTGCAAGACACTATTCAGCTAAAAGTAATAATAAAAAAAAGAATGATTCGTTAAGGGGGCTAACAAGTCCGTTCATTCATTCGTTCGTTCATTCGTTCCAAGGTTATTCTAGTTATTATAAATAACTATAATAGATATAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13682
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Nonsense 120 290 3 5
ENSDART00000132380 Nonsense 120 290 5 7
ENSDART00000139225 Nonsense 120 225 4 5
Genomic Location (Zv9):
Chromosome 19 (position 4890092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4163653
GRCz11 19 4094479
KASP Assay ID:
2261-2828.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTTATATATTGTCCTCTCAGGCTCTAAGMGGCTGGAGTATGAAGACTG[T/A]GTGTGGCATGAGGAGTGTTTTGTTTGCTGTGGTTGTGAGCAGCCCATCGG
Long Flanking Sequence:
GACTGTCTGAATGTACTAAGAGGATAAAATTACAACTGAAAGTGGCAGCGCTCTCTCTCCTCCCTCTTTCATTCAAAACACACTTTAAGATCAGGTGAGCCGTTTCCTACCAAACCTGTATGCTGCAACTCGTGCATTTTTCAGATTCCACGTGCGTTTCTGTGGATACACACTTCCAGCCCACAGATTTCACACAGCTGAAATGGAACTCAAAACACGAGCGGCTTTTGTAGATATAGAGTCATTCAGCAGGAATATGACATCACATCATGTGTAGTTGGTCATGATAATGCAAAGGTTTAACTGTGTGGTATTTGCTTATCGAATGTGCTCAGTCACCTGAAACAGTAAAAGTGCTTGAGAAAGAACCTGTCGTGGATAATTAGGCCTGTTTTTCTGAGTAAATCATCCATTAATCATGCAATGATTTAATGACCTAAAAGTTATATGAAGTTATATATTGTCCTCTCAGGCTCTAAGCGGCTGGAGTATGAAGACTG[T/A]GTGTGGCATGAGGAGTGTTTTGTTTGCTGTGGTTGTGAGCAGCCCATCGGCGCCCAGTCCTTTATTCCCGATAAGGACGAGTACTACTGCGTGCCCTGTTATGAGGGACGATTCGCTCCGCGCTGCGCTCACTGCAAACAGGTGACACAAAAACTACTCATTTTATTATAATTCATCCATTAAAGATGAACTATTATGCCTCTTTTTTTATAAGATGTAAAATAAATCTTTGTTGTTCCTAGAGTGTGTATGTGACGTTTCAACTCAAAATACACAACAAATAATGTTTTTTAAGTCTTTGAAACTGCCGTTTTGATGCTAATTATGAAATTTTGGTGACTTGTCACTTTAAATTCAAATGAGATTGTGCTCTTTTTTTAAAGAAGGGGGAGCTACAAAAGCATGTGTCAGTAAAGTGGCAGATTCAAAAACAAGACTTTTGCTCTATGCTAATGAGAGAGATTGTCACTAATGGGCGGGGCTTTCCCCCTCTAATGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29137
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Nonsense 122 290 3 5
ENSDART00000132380 Nonsense 122 290 5 7
ENSDART00000139225 Nonsense 122 225 4 5
Genomic Location (Zv9):
Chromosome 19 (position 4890086)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4163647
GRCz11 19 4094473
KASP Assay ID:
2261-2827.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATTGTCCTCTCAGGCTCTAAGCGGCTGGAGTATGAAGACTGTGTGTG[G/A]CATGAGGAGTGTTTTGTTTGCTGTGGTTGTGAGCAGCCCATCGGCGCCCA
Long Flanking Sequence:
CTGAATGTACTAAGAGGATAAAATTACAACTGAAAGTGGCAGCGCTCTCTCTCCTCCCTCTTTCATTCAAAACACACTTTAAGATCAGGTGAGCCGTTTCCTACCAAACCTGTATGCTGCAACTCGTGCATTTTTCAGATTCCACGTGCGTTTCTGTGGATACACACTTCCAGCCCACAGATTTCACACAGCTGAAATGGAACTCAAAACACGAGCGGCTTTTGTAGATATAGAGTCATTCAGCAGGAATATGACATCACATCATGTGTAGTTGGTCATGATAATGCAAAGGTTTAACTGTGTGGTATTTGCTTATCGAATGTGCTCAGTCACCTGAAACAGTAAAAGTGCTTGAGAAAGAACCTGTCGTGGATAATTAGGCCTGTTTTTCTGAGTAAATCATCCATTAATCATGCAATGATTTAATGACCTAAAAGTTATATGAAGTTATATATTGTCCTCTCAGGCTCTAAGCGGCTGGAGTATGAAGACTGTGTGTG[G/A]CATGAGGAGTGTTTTGTTTGCTGTGGTTGTGAGCAGCCCATCGGCGCCCAGTCCTTTATTCCCGATAAGGACGAGTACTACTGCGTGCCCTGTTATGAGGGACGATTCGCTCCGCGCTGCGCTCACTGCAAACAGGTGACACAAAAACTACTCATTTTATTATAATTCATCCATTAAAGATGAACTATTATGCCTCTTTTTTTATAAGATGTAAAATAAATCTTTGTTGTTCCTAGAGTGTGTATGTGACGTTTCAACTCAAAATACACAACAAATAATGTTTTTTAAGTCTTTGAAACTGCCGTTTTGATGCTAATTATGAAATTTTGGTGACTTGTCACTTTAAATTCAAATGAGATTGTGCTCTTTTTTTAAAGAAGGGGGAGCTACAAAAGCATGTGTCAGTAAAGTGGCAGATTCAAAAACAAGACTTTTGCTCTATGCTAATGAGAGAGATTGTCACTAATGGGCGGGGCTTTCCCCCTCTAATGACGCATACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7873
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Nonsense 181 290 4 5
ENSDART00000132380 Nonsense 181 290 6 7
ENSDART00000139225 Nonsense 181 225 5 5
Genomic Location (Zv9):
Chromosome 19 (position 4888571)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4162132
GRCz11 19 4092958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NCTCAAACAGACCTTGGTTCAGGGTGGTGTTACGTACAGRGAYGAGCCCT[G/A]GCATAAAGAGTGTTTCCTGTGTWCGGGATGTAAAGTTCAGTTAGCCGGAC
Long Flanking Sequence:
CATAACTTATAACATTTCCCCCATATGACTAGCATAACATGCTGCTAACTTGTTTCTAGGATTGCTTGTTTCTTAACATTTACAAGCATGAATTGTTGTTAGCATGCGCTTTAAACCACATAAATAACATTTAATCATGTTGCTAACATGAATTAGCATGTTGCTTTTATGATAATCACATTGTTAACACAAATTAGCATATTCTAAACTTTAATTAGCATATTGCTAATGTAAACAAATAAAGCTAGCATTTTTTTATATAATTAATACACTGGGAAAGCATGACAACATATATTTTTTAATACAGTATGTACAGTATGTTTTTGTCTTATGACACTGTAAAAAAAAGATTGCAAACCACATACTAATATTAATATTGAGTATTTGAATGTTTCATTCAGTTTGTTCAATCAAATGACATTAGAATTAAGTTTTTTTTAATCTGTCTTATCTCAAACAGACCTTGGTTCAGGGTGGTGTTACGTACAGGGACGAGCCCT[G/A]GCATAAAGAGTGTTTCCTGTGTACGGGATGTAAAGTTCAGTTAGCCGGACAGCCTTTCACCACGCAGGGTGAAGATCCATACTGCGTCAAGTGCTTCAGCAACTTGTACGCCCAAAAATGTGCCGCCTGCGAAAAACCCATCACAGGTCAGTGTGTGTGAGTGTGTCCTTCATAACAAAACCACGATTCACAACATCAACTAACACTAACGCTTTGTCAGAAACAAGAAACAGTTGTCACATAAACAGGGTCATGTGTTTTGTGGCATGCAGTGCTTCATAATGACGAGTATTACATCTAGTAGGTCATGAACTATTAGTCAAAGTCAGATCACATTTCTGGACTGTTTATATAGTTTTGATACTGATCTCAAAGCAAGTTTAGCAAAGGGTCTGGTTGCCATTACAATGATTTTTCATTACCTCATGCTCATGTCATTCCAAACTCTTGATTTTCTCATATCATAAATTCTGTGAGACACAGAATGGGATGTTTAACAG
Associated Phenotype:
Not determined