Busch Lab

ZMP

zgc:56039

Ensembl ID:
ENSDARG00000059059
ZFIN ID:
ZDB-GENE-030131-7832
Description:
Protein EMSY [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUV7]
Human Orthologue:
C11orf30
Human Description:
chromosome 11 open reading frame 30 [Source:HGNC Symbol;Acc:18071]
Mouse Orthologue:
2210018M11Rik
Mouse Description:
RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34801 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34801
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101661 Essential Splice Site 518 1150 9 18
Genomic Location (Zv9):
Chromosome 10 (position 356905)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 291800
GRCz11 10 291800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTGGCCACGCTCGGGGGCAAGATCATCACCACCAGCATGGTGTCCGG[T/C]AAGTGTCATTACCACACTGTCATTAATTAGTGACTTACCATATTTATCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4352
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101661 Nonsense 599 1150 11 18
Genomic Location (Zv9):
Chromosome 10 (position 353601)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 288496
GRCz11 10 288496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCGACCCATCACYAAAATGATTGTGACGCAGCCCAAGAGCCTCGGCGCA[G/T]GAGTGCAGCCCTCCACCACCACCAAGATCATCCCCACTAAGATCGTCTAC
Associated Phenotype:
Not determined