Busch Lab

ZMP

zgc:154086

Ensembl ID:
ENSDARG00000059037
ZFIN ID:
ZDB-GENE-061013-333
Description:
MOV10-like 1 [Source:RefSeq peptide;Acc:NP_001070795]
Human Orthologue:
MOV10L1
Human Description:
Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse) [Source:HGNC Symbol;Acc:7201]
Mouse Orthologue:
Mov10l1
Mouse Description:
Moloney leukemia virus 10-like 1 Gene [Source:MGI Symbol;Acc:MGI:1891384]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8069
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040838 Essential Splice Site 241 920 5 22
Genomic Location (Zv9):
Chromosome 2 (position 201616)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 169742
GRCz11 2 157195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCAGCCCCTGCAGGTGCTCACGGTCTCGGCSCCGCCCACGCCGCTCAGG[T/G]CTGATTTATTAGTGCWGCTGTCTGCAAGAGTCATGAGCAGGTTTTAAAGT
Associated Phenotype:
Not determined