Busch Lab

ZMP

jam2a

Ensembl ID:
ENSDARG00000058996
ZFIN ID:
ZDB-GENE-031204-3
Description:
junctional adhesion molecule 2a [Source:RefSeq peptide;Acc:NP_001091734]
Human Orthologue:
JAM2
Human Description:
junctional adhesion molecule 2 [Source:HGNC Symbol;Acc:14686]
Mouse Orthologue:
Jam2
Mouse Description:
junction adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1933820]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
hu3319 Nonsense Confirmed mutation in F2 line Not yet available
sa39528 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
hu3319
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081989 Nonsense 40 307 3 13
ENSDART00000133165 None None 98 None 4
ENSDART00000135944 Nonsense 40 185 3 5
Genomic Location (Zv9):
Chromosome 1 (position 476576)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 606700
GRCz11 1 601879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGATGAGCTCTAAAATCTGTCTCTGTCCACAGACGCAGAGCTCTCCTG[C/A]GAGTTCAAGACTGAGAAAGACACCAACCCTCGCATCGAGTGGAAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39528
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081989 Essential Splice Site 215 307 8 13
ENSDART00000133165 None None 98 None 4
ENSDART00000135944 None None 185 None 5
Genomic Location (Zv9):
Chromosome 1 (position 478673)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 608797
GRCz11 1 603976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTAAAGCACCCTAGCAACCACATTCTGAAAACTCAGAACATTCGTTTA[T/A]ATTCATATGATAATAAAGGCCTGTGCTGCGTTTTGGAATCAACAGAATGC
Associated Phenotype:
Not determined