Busch Lab

ZMP

LOC792822

Ensembl ID:
ENSDARG00000058949
Human Orthologue:
SPIN1
Human Description:
spindlin 1 [Source:HGNC Symbol;Acc:11243]
Mouse Orthologue:
Spin1
Mouse Description:
spindlin 1 Gene [Source:MGI Symbol;Acc:MGI:109242]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44717 Nonsense Mutation detected in F1 DNA Not yet available
sa10031 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081922 Nonsense 98 262 3 5
Genomic Location (Zv9):
Chromosome 10 (position 2598357)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2544095
GRCz11 10 2571694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAACCCCTCGCTCTACCTGATCAAATACGACGGCTTCGACTGCGTCTA[C/A]GGCCTGGAGCTGCACAAGGATGAGCGGGTGCAAGGCCTGGAGGTCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081922 Nonsense 165 262 4 5
Genomic Location (Zv9):
Chromosome 10 (position 2598953)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2544691
GRCz11 10 2572290
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGAGTGGAGAGGGATGGTTCTGGCCCGAGCGCCCATCATGAACACATG[G/A]TTCTACATCACGTATGAGAAAGACCCGGTGCTCTACATGTACCAGCTGCT
Associated Phenotype:
Not determined