Busch Lab

ZMP

si:ch211-256m12.5

Ensembl ID:
ENSDARG00000058885
ZFIN ID:
ZDB-GENE-100922-181
Human Orthologue:
TTC29
Human Description:
tetratricopeptide repeat domain 29 [Source:HGNC Symbol;Acc:29936]
Mouse Orthologue:
Ttc29
Mouse Description:
tetratricopeptide repeat domain 29 Gene [Source:MGI Symbol;Acc:MGI:1920551]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22741 Essential Splice Site Available for shipment Available now
sa45560 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28569
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081826 None None 409 None 10
ENSDART00000148096 Nonsense 15 440 1 9
Genomic Location (Zv9):
Chromosome 16 (position 5441629)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4668182
GRCz11 16 4497471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCAGCATGTCTTCGAAAACTCGGTTTTCTATGATCCACAGTCCTCAG[A/T]AAACCAACAGGACAACACCGACATCCAAGTAAACTCGTATTTTTCTCTCA
Long Flanking Sequence:
TATATTTTAGTTATCTATGTTATTAGTAACGTTTGTATTTTTTGGTTGGCCTGTGTAAATTGTATATGTGCTCTATAAATAAAACTAAATATAAACAAAATCATAAATAACACTACAGCGACCTCGTATGGTCACCAGGGAAGCTCTTCAGCTTTTGTGGACTTGAAGTATCAACAAAGCTTATATAACAGGTTATTTATTACTCGTCACTACATACCATCCCATTACTTTCAGTCATTTAAATTGAGTGGCAAATTTCTATATAAGTTTTGCACGAATTCATCTCACAGTAGTTAGTTGTCAGCTTGGTCGCTATGGCAACATTTTGTTAACGCTGACAAATCTGACAACCAGGTAACGTTAAATCGCATCTTCATACAAAGTAACGTGTCTTGTTATATCTGTCGTTTTTAGCTAAATTATAACTTCTTTTTTGTTATTTAAACTTACTCAGCAGCATGTCTTCGAAAACTCGGTTTTCTATGATCCACAGTCCTCAG[A/T]AAACCAACAGGACAACACCGACATCCAAGTAAACTCGTATTTTTCTCTCATACTGAACGTTTTGCCTTCAAACAAAATGCGTGAATGTTTTTTTTTTTTTTGTTTGTTTTTTTTTTTTTTTTTTGTATGTTTAGGTCTTTCCCTCGGTGTAATAAGAAGAATTCCGGCAGTCCTGTTGGAGAGGAACCAAACAAAATGACTGAGACCGAAATAGCACAGTAAGACAGATACAGTTGATTATCTATTGTTTATTTTGATCGTCATTAGCCTCTATCAGTGTAGTAGCTATTCTTCCTGGGGTCCAACGAATTAAAATAATGATAAAAATAATAATAATTAAGCTCAACAGTCAAGACTAGAAGACAAATTTACATTGTATTAAAACATTTGAAAGCTATAACCAAATTTCATACAAAACATAACAAAAGACAATGATGCTAAAACCATTTTAAAAGACAAATTTAAACCATAATAATAAAAAAACTAACACCAAACATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22741
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081826 Essential Splice Site 13 409 2 10
ENSDART00000148096 None None 440 None 9
Genomic Location (Zv9):
Chromosome 16 (position 5441679)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4668232
GRCz11 16 4497521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACCAACAGGACAACACCGACATCCAAGTAAACTCGTATTTTTCTCTC[A/T]TACTGAACGTTTTGCCTTCAAACAAAATGCGTGAATGTTTTTTTTTTTTT
Long Flanking Sequence:
CTGTGTAAATTGTATATGTGCTCTATAAATAAAACTAAATATAAACAAAATCATAAATAACACTACAGCGACCTCGTATGGTCACCAGGGAAGCTCTTCAGCTTTTGTGGACTTGAAGTATCAACAAAGCTTATATAACAGGTTATTTATTACTCGTCACTACATACCATCCCATTACTTTCAGTCATTTAAATTGAGTGGCAAATTTCTATATAAGTTTTGCACGAATTCATCTCACAGTAGTTAGTTGTCAGCTTGGTCGCTATGGCAACATTTTGTTAACGCTGACAAATCTGACAACCAGGTAACGTTAAATCGCATCTTCATACAAAGTAACGTGTCTTGTTATATCTGTCGTTTTTAGCTAAATTATAACTTCTTTTTTGTTATTTAAACTTACTCAGCAGCATGTCTTCGAAAACTCGGTTTTCTATGATCCACAGTCCTCAGAAAACCAACAGGACAACACCGACATCCAAGTAAACTCGTATTTTTCTCTC[A/T]TACTGAACGTTTTGCCTTCAAACAAAATGCGTGAATGTTTTTTTTTTTTTTGTTTGTTTTTTTTTTTTTTTTTTGTATGTTTAGGTCTTTCCCTCGGTGTAATAAGAAGAATTCCGGCAGTCCTGTTGGAGAGGAACCAAACAAAATGACTGAGACCGAAATAGCACAGTAAGACAGATACAGTTGATTATCTATTGTTTATTTTGATCGTCATTAGCCTCTATCAGTGTAGTAGCTATTCTTCCTGGGGTCCAACGAATTAAAATAATGATAAAAATAATAATAATTAAGCTCAACAGTCAAGACTAGAAGACAAATTTACATTGTATTAAAACATTTGAAAGCTATAACCAAATTTCATACAAAACATAACAAAAGACAATGATGCTAAAACCATTTTAAAAGACAAATTTAAACCATAATAATAAAAAAACTAACACCAAACATATGATACTTAAACATCAAACATATGACTTTACTGATTACTCATTCATTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45560
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081826 Nonsense 227 409 6 10
ENSDART00000148096 Nonsense 224 440 5 9
Genomic Location (Zv9):
Chromosome 16 (position 5445345)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4671898
GRCz11 16 4501187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCCAGACGGTCTACACGCTGATGGCACAGAGATCTCTGCAGGATCAA[C/T]AATATGAGCAGGCCATTAAGATGTCTAGAAAGGCCTATACTATTGCTAAA
Long Flanking Sequence:
TGCTCACATCATCCAATCAGATAAGAAGAACCGAGAAGGTAGCATTTGAAGGCTTGAAAATACAAACTGTTTCTCAATTCTAAAACTGTATTTGCACGCAATTGACAAATAGTCACAGGCAAATTAAACTTTAGTAACAAGGCAACAGTGGCCCGATCGGGCCAGTAACGATCCTGTCTACTGTCCCGAGCATCTCACACGCTGGCCCCGGGCCATCAGGCAGTCCTTATTGTTGAGCCCTGGATAGAATATAGTTTGTACAGTATAACAATTATTATGTCTATGCGAAGTCCCCAAAAAGATTGCTGTAAAAGTGTCTGTGTGTGTCTGCATGTTTTACAGGTGATCTTGAGCTTGCACAAGAGCATTTGGAGGTGTTTTATCAGCTAACCGCAGGCCGAACTTGGCAGGACAGCAACGGCCGGATGCAGCACTCTCGCTCATGTGAAGAGCTCCAGACGGTCTACACGCTGATGGCACAGAGATCTCTGCAGGATCAA[C/T]AATATGAGCAGGCCATTAAGATGTCTAGAAAGGCCTATACTATTGCTAAAGAGTGTATGCACACACTGTTCACTCTTAAGGCTGATTTATACTTCTGCGTCAAGAGCACGCGTATGCTATGGCGCAACCTACACATAGACTCATAGCCCTCTCCGTGGCCGTCGCGACATTGACGCACACCTCAAAAGAATGTAACTACGCATTGCAACAACGCATAGCGCAAGTTCTGTGATTGGTCGGCTTGGTAGCACTGACGAGTGTGAGCGGGACCTCACTGCTAGCTAGTGTTTAGGAAGTGTTATTACAGAGGAACACAAACAGTGCTCAGAGTTATAAATGCACGGCAACGAGCAAGGCTTGTGCCGTGGGTCACGCCGATCTTTTGACGCAGAAGTATAAACCAGACTTGACAGTGATTTACATTAGCTATAGGTTCACAGTTGGCCATGCACCCTAACTCAACTACACTGTAAAAAAATTCTGTATTCCACTCAATCGAT
Associated Phenotype:
Not determined